Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU082981

Sigma-Aldrich

MISSION® esiRNA

targeting human SENP6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCAGAGCAGAGCGTGAACTACGAAGCATTCCAGAAGACTCAGAGTTAAATACAGTTACATTGCCAAGAAAAGCAAGAATGAAAGACCAGTTTGGCAATTCTATTATCAACACACCTCTGAAACGTCGTAAAGTGTTTTCTCAAGAACCTCCAGATGCTTTAGCTTTAAGCTGCCAAAGTTCCTTTGACAGTGTCATTTTAAACTGTCGAAGTATACGAGTAGGAACACTCTTCCGGCTGTTAATAGAGCCTGTAATTTTTTGTTTAGATTTTATCAAGATACAGCTAGACGAACCAGACCATGATCCTGTAGAGATTATATTAAATACCTCTGATCTAACTAAATGTGAATGGTGTAATGTCCGAAAATTACCTGTAGTGTTTCTTCAAGCAATTCCAGCAGTTTATCAAAAGCTGAGCATCCAACTGCAAATGAA

Ensembl | nº de acceso humano

ENSG00000112701

Nº de acceso NCBI

NM_001100409

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SENP6(26054) , SENP6(26054)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Neil Hattersley et al.
Molecular biology of the cell, 22(1), 78-90 (2010-12-15)
Promyelocytic leukemia protein (PML) is the core component of PML-nuclear bodies (PML NBs). The small ubiquitin-like modifier (SUMO) system (and, in particular, SUMOylation of PML) is a critical component in the formation and regulation of PML NBs. SUMO protease SENP6
Barbara Stefanska et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(12), 3118-3132 (2014-04-26)
We utilized whole-genome mapping of promoters that are activated by DNA hypomethylation in hepatocellular carcinoma (HCC) clinical samples to shortlist novel targets for anticancer therapeutics. We provide a proof of principle of this approach by testing six genes short-listed in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico