Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU082881

Sigma-Aldrich

MISSION® esiRNA

targeting human DGKA

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCTGGCTCGATGCCTAAGATGGGGAGGAGGTTATGAAGGACAGAATCTGGCAAAGATCCTCAAGGATTTAGAGATGAGTAAAGTGGTACATATGGATCGATGGTCTGTGGAGGTGATACCTCAACAAACTGAAGAAAAAAGTGACCCAGTCCCCTTTCAAATCATCAATAACTACTTCTCTATTGGCGTGGATGCCTCTATTGCTCATCGATTCCACATCATGCGAGAGAAATATCCGGAGAAGTTCAACAGCAGAATGAAGAACAAGCTATGGTACTTCGAATTTGCCACATCTGAATCCATCTTCTCAACATGCAAAAAGCTGGAGGAGTCTTTGACAGTTGAGATCTGTGGGAAACCGCTGGATCTGAGCAACCTGTCCCTAGAAGGCATCGCAGTGCTA

Ensembl | nº de acceso humano

ENSG00000065357

Nº de acceso NCBI

NM_001345

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... DGKA(1606) , DGKA(1606)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Inan Olmez et al.
Neuro-oncology, 20(2), 192-202 (2017-10-20)
The mesenchymal phenotype in glioblastoma (GBM) and other cancers drives aggressiveness and treatment resistance, leading to therapeutic failure and recurrence of disease. Currently, there is no successful treatment option available against the mesenchymal phenotype. We classified patient-derived GBM stem cell
Jie Li et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 26(14), 3843-3855 (2020-04-29)
Although platinum compounds are the first-line treatment for ovarian cancer, the majority of patients relapse and develop resistance to treatment. However, the mechanism underlying resistance is unclear. The goal of our study is to decipher the mechanism by which a

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico