Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU082311

Sigma-Aldrich

MISSION® esiRNA

targeting human AMACR, C1QTNF3-AMACR

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCATGGAAACATGGAGGAACAGTATTACAGTGTCCTACCACTCTAATCAAGAAAAGAATTACAGACTCTGATTCTACAGTGATGATTGAATTCTAAAAATGGTTATCATTAGGGCTTTTGATTTATAAAACTTTGGGTACTTATACTAAATTATGGTAGTTATTCTGCCTTCCAGTTTGCTTGATATATTTGTTGATATTAAGATTCTTGACTTATATTTTGAATGGGTTCTAGTGAAAAAGGAATGATATATTCTTGAAGACATCGATATACATTTATTTACACTCTTGATTCTACAATGTAGAAAATGAGGAAATGCCACAAATTGTATGGTGATAAAAGTCACGTGAAACAGAGTGATTGGTTGCATCCAGGCCTTTTGTCTTGGTGTTCATGATCTCCC

Ensembl | nº de acceso humano

ENSG00000082196

Nº de acceso NCBI

NM_014324

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... AMACR(23600) , C1QTNF3(23600)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lei Chen et al.
Inflammation, 42(4), 1350-1359 (2019-03-20)
C1q/tumor necrosis factor-related protein-3 (CTRP3) is a novel, certified, adipokine that beneficially regulates metabolism and inflammation in the cardiovascular system. Atherosclerotic plaque rupturing and secondary thrombosis cause vascular disorders, such as myocardial infarction and unstable angina. However, the underlying role
Daniel W Youngstrom et al.
Journal of orthopaedic research : official publication of the Orthopaedic Research Society, 38(5), 996-1006 (2019-12-07)
C1q/TNF-related protein 3 (CTRP3) is a cytokine known to regulate a variety of metabolic processes. Though previously undescribed in the context of bone regeneration, high throughput gene expression experiments in mice identified CTRP3 as one of the most highly upregulated

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico