Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU081071

Sigma-Aldrich

MISSION® esiRNA

targeting human DUSP6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCCCTTCAGCAGTTTCTCTTGGCAGCATCAGCTGGGCTGCTTTCTTTGTGTGTGGCCCCAGGTGTCAAAATGACACCAGCTGTCTGTACTAGACAAGGTTACCAAGTGCGGAATTGGTTAATACTAACAGAGAGATTTGCTCCATTCTCTTTGGAATAACAGGACATGCTGTATAGATACAGGCAGTAGGTTTGCTCTGTACCCATGTGTACAGCCTACCCATGCAGGGACTGGGATTCGAGGACTTCCAGGCGCATAGGGTAGAACCAAATGATAGGGTAGGAGCATGTGTTCTTTAGGGCCTTGTAAGGCTGTTTCCTTTTGCATCTGGAACTGACTATATAATTGTCTTCAATGAAGACTAATTCAATTTTGCATATAGAGGAGCCAAAGAGAGATTTCA

Ensembl | nº de acceso humano

ENSG00000139318

Nº de acceso NCBI

NM_022652

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... DUSP6(1848) , DUSP6(1848)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiuyan Feng et al.
American journal of physiology. Renal physiology, 308(10), F1119-F1127 (2015-03-13)
Thiazide-sensitive sodium chloride cotransporter (NCC) plays an important role in maintaining blood pressure. Aldosterone is known to modulate NCC abundance. Previous studies reported that dietary salts modulated NCC abundance through either WNK4 [with no lysine (k) kinase 4]-SPAK (Ste20-related proline
Yifan Gu et al.
International journal of clinical and experimental medicine, 8(6), 8590-8598 (2015-08-27)
MicroRNAs (miRNAs) are small, non-coding RNAs that modulate gene expression by negatively regulating the stability or translational efficiency of their target mRNAs. The aim of this study was to investigate the expression of microRNA-145 (miR-145) in human papillary thyroid cancer

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico