Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU080041

Sigma-Aldrich

MISSION® esiRNA

targeting human BTG3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAGGGCCCTTGATAAGGTTACCTCTGATTATCATTCAGGATCCTCTTCTTCAGATGAAGAAACAAGTAAGGAAATGGAAGTGAAACCCAGTTCGGTGACTGCAGCCGCAAGTCCTGTGTACCAGATTTCAGAACTTATATTTCCACCTCTTCCAATGTGGCACCCTTTGCCCAGAAAAAAGCCAGGAATGTATCGAGGGAATGGCCATCAGAATCACTATCCTCCTCCTGTTCCATTTGGTTATCCAAATCAGGGAAGAAAAAATAAACCATATCGCCCAATTCCAGTGACATGGGTACCTCCTCCTGGAATGCATTGTGACCGGAATCACTGGATTAATCCTCACATGTTAGCACCTCACTAACTTCGTTTTTGATTGTGTTGGTGTCATGTTGAGAAAAAGG

Ensembl | nº de acceso humano

ENSG00000154640

Nº de acceso NCBI

NM_006806

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... BTG3(10950) , BTG3(10950)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
HCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qi An et al.
Reproductive sciences (Thousand Oaks, Calif.), 24(10), 1462-1468 (2017-02-12)
Epithelial ovarian cancer (EOC) is the leading cause of cancer-related death among all the gynecological malignancies of the female genital system, and its incidence and mortality rates continue to rise. B-cell translocation gene 3 (BTG3) plays an important role in
Xinfang Yu et al.
Journal of hematology & oncology, 13(1), 40-40 (2020-05-03)
Aberrant activation of DNA damage response (DDR) is a major cause of chemoresistance in colorectal cancer (CRC). CHK1 is upregulated in CRC and contributes to therapeutic resistance. We investigated the upstream signaling pathways governing CHK1 activation in CRC. We identified

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico