Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU079951

Sigma-Aldrich

MISSION® esiRNA

targeting human PLAGL1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGAAAACGAGACTGGGACTATGGCTTATTCAGTGATGACTGGCTTGAGATGATAAGAGAATTCTCGAACTGCATGTATTGTGCCAATCTGTCCTGAGTGTTCATGCTTTGTACCAAATTTAATGAACGCGTGTTCTGTAATCAAACTGCAAATATTGTCATAACCAACATCCAAAATGACGGCTGCTATATATAAGTGTTTGTCATATGGAATTTAATCGTAAGCCATGATCATAATGTTAACTAAATAACTTTATGTGGCACTGCCTAGTAAGGGAACTATGGAAAGGTTTGGATTTCTCCAAATCTGGGAGAATTTTCAAAATAAGAAAATAACCTTTATATGATATACTATGACTAGGCTGTGTATTTCTTTTCAGGGATTTTTCTACCTTCAGGGTTGGA

Ensembl | nº de acceso humano

ENSG00000118495

Nº de acceso NCBI

NM_002656

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PLAGL1(5325) , PLAGL1(5325)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Rebekah R Starks et al.
International journal of molecular sciences, 21(21) (2020-11-12)
During pregnancy, the placenta is important for transporting nutrients and waste between the maternal and fetal blood supply, secreting hormones, and serving as a protective barrier. To better understand placental development, we must understand how placental gene expression is regulated.
Yeyou Liang et al.
Metabolism: clinical and experimental, 64(12), 1682-1693 (2015-10-13)
Evidence shows that both macrophage migration inhibitory factor (MIF) and GLUT4 glucose transporter are involved in diabetic cardiomyopathy (DCM), but it remains largely unknown whether and how MIF regulates GLUT4 expression in cardiomyocytes. The present study aims to investigate the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico