Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU078541

Sigma-Aldrich

MISSION® esiRNA

targeting human GLS2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATTGGACAAGCTGGGGAACAGCCATAGGGGGACCAGCTTCTGCCAGAAGTTGGTGTCTCTCTTCAATTTCCACAACTATGACAACCTGAGGCACTGTGCTCGGAAGTTAGACCCACGGCGTGAAGGGGCAGAAATTCGGAACAAGACTGTGGTCAACCTGTTATTTGCTGCCTATAGTGGCGATGTCTCAGCTCTTCGAAGGTTTGCCTTGTCAGCCATGGATATGGAACAGAAAGACTATGACTCGCGCACAGCTCTGCATGTTGCTGCAGCTGAAGGACACATCGAAGTTGTTAAATTCCTGATCGAGGCTTGCAAAGTGAATCCTTTTGCCAAGGACAGGTGGGGCAACATTCCCCTGGATGATGCTGTGCAGTTCAACCATCTGGAGGTGGTCAAACTGCT

Ensembl | nº de acceso humano

ENSG00000135423

Nº de acceso NCBI

NM_013267

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... GLS2(27165) , GLS2(27165)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS
OWS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xulu Ye et al.
Anticancer research, 36(11), 6021-6029 (2016-10-30)
Inhibition of glutaminolysis has been reported as a promising therapeutic strategy to target several solid carcinomas. We aimed to investigate the effects of glutaminolysis on cell proliferation in lung squamous cell carcinoma cell lines and to explore the potential of
Ying Niu et al.
Life sciences, 237, 116893-116893 (2019-10-14)
Gastric cancer (GC) is a common human malignancy tumor of digestive tract in worldwide. Physcion 8-O-β-glucopyranoside (PG) exhibits anti-tumor effects in various cancer cells. This study aimed to explore the biological behavior effects of PG on GC cells, and determine
Jason D Arroyo et al.
Nucleic acids research, 42(9), 6064-6077 (2014-03-07)
Unlike short interfering RNAs (siRNAs), which are commonly designed to repress a single messenger RNA (mRNA) target through perfect base pairing, microRNAs (miRNAs) are endogenous small RNAs that have evolved to concurrently repress multiple mRNA targets through imperfect complementarity. MicroRNA

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico