Todas las fotos(1)

Documentos clave

EHU078041

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human PMAIP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Todas las fotos(1)

About This Item

Código UNSPSC:

41105324

NACRES:

NA.51

descripción

Nivel de calidad

100

Línea del producto

MISSION^®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTCTCAGGAGGTGCACGTTTCATCAATTTGAAGAAAGACTGCATTGTAATTGAGAGGAATGTGAAGGTGCATTCATGGGTGCCCTTGGAAACGGAAGATGGAATACATCAAAGTGAATTTCTGTTCAAGTTTTCCCAGATTATCATTCTTTGGGATGAGAGAACATTATAAAACCACTTTGTTTATTTTAAAGCAAGAATGGAAGACCCTTGAAAATAAAGAAGTAATTATTGACACATTTCTTTTTTACTTAGAGAATCGTTCTAGTGTTTTTGCCGAAGATTACCGCTGGCCTACTGTGAAGGGAGATGACCTGTGATTAGACTGGGCGGCTGGGGAGAAACAGTTCAGTGCATTGTTGTTGTTGCTGTTTTTGGTGTTTTGCTTTTCAGTGCCAACTCAGCAC

Ensembl | nº de acceso humano

ENSG00000141682

Nº de acceso NCBI

NM_021127

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PMAIP1(5366) , PMAIP1(5366)

Categorías relacionadas

MISSION® esiRNA

Descripción general

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

The BET-Bromodomain Inhibitor JQ1 synergized ABT-263 against colorectal cancer cells through suppressing c-Myc-induced miR-1271-5p expression.

Zhenqian Wu et al.

Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 95, 1574-1579 (2017-09-28)

Colorectal cancer (CRC) cells undergo apoptosis in the presence of the small-molecule inhibitor ABT-263 by up-regulating antiapoptotic Bcl-2 family members. However, the resistance to ABT-263 gradually developed in most solid tumors due to its low affinity to Mcl-1. Here, we

Repression of Mcl-1 and disruption of the Mcl-1/Bak interaction in myeloma cells couple ER stress to mitochondrial apoptosis.

Patricia Gomez-Bougie et al.

Cancer letters, 383(2), 204-211 (2016-10-25)

As myeloma cells actively produce and secrete immunoglobulins, they are prone to ER stress, which if unresolved leads to apoptosis. We found that myeloma cell death induced by the ER stressor Thapsigargin was highly variable, ranging from 2 to 89%.

CB002, a novel p53 tumor suppressor pathway-restoring small molecule induces tumor cell death through the pro-apoptotic protein NOXA.

Liz J Hernandez-Borrero et al.

Cell cycle (Georgetown, Tex.), 17(5), 557-567 (2017-07-28)

P53 tumor suppressor gene mutations occur in the majority of human cancers and contribute to tumor development, progression and therapy resistance. Direct functional restoration of p53 as a transcription factor has been difficult to achieve in the clinic. We performed

Ursolic acid facilitates apoptosis in rheumatoid arthritis synovial fibroblasts by inducing SP1-mediated Noxa expression and proteasomal degradation of Mcl-1.

Eugene Y Kim et al.

FASEB journal : official publication of the Federation of American Societies for Experimental Biology, fj201800425R-fj201800425R (2018-05-26)

Rheumatoid arthritis (RA) is characterized by hyperplastic pannus formation mediated by activated synovial fibroblasts (RASFs) that cause joint destruction. We have shown earlier that RASFs exhibit resistance to apoptosis, primarily as a result of enhanced expression of myeloid cell leukemia-1

The Novel Histone Deacetylase Inhibitor, OBP-801, Induces Apoptosis in Rhabdoid Tumors by Releasing the Silencing of NOXA.

Yohei Sugimoto et al.

Molecular cancer therapeutics, 19(10), 1992-2000 (2020-08-28)

Rhabdoid tumor is an aggressive, early childhood tumor. Biallelic inactivation of the SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1 (SMARCB1)/integrase interactor 1 (INI1) gene is the only common genetic feature in rhabdoid tumors. Loss of SMARCB1 function

Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico