Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU077951

Sigma-Aldrich

MISSION® esiRNA

targeting human ARPC2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGATTTCGATGGGGTCCTCTATCATATTTCAAATCCTAATGGAGACAAAACAAAAGTGATGGTCAGTATTTCTTTGAAATTCTACAAGGAACTTCAGGCACATGGTGCTGATGAGTTATTAAAGAGGGTGTACGGGAGTTTCTTGGTAAATCCAGAATCAGGATACAATGTCTCTTTGCTATATGACCTTGAAAATCTTCCGGCATCCAAGGATTCCATTGTGCATCAAGCTGGCATGTTGAAGCGAAATTGTTTTGCCTCTGTCTTTGAAAAATACTTCCAATTCCAAGAAGAGGGCAAGGAAGGAGAGAACAGGGCAGTTATCCATTATAGGGATGATGAGACCATGTATGTTGAGTCTAAAAAGGACAGAGTCACAGTAGTCTTCAGCACAGTGTTTAAGGATGACGACGATGTGGTCATTGGAAAGGTGTTCATGCAG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yae Jin Yoon et al.
Biochemical pharmacology, 163, 46-59 (2019-02-03)
Metastasis is the leading cause of cancer mortality and cancer cell migration is an essential stage of metastasis. We identified benproperine (Benp, a clinically used antitussive drug) as an inhibitor of cancer cell migration and an anti-metastatic agent. Benp selectively
Zhongle Cheng et al.
Oncology reports, 41(6), 3189-3200 (2019-04-20)
Actin-related protein 2/3 complex (ARPC2) is an actin‑binding component involved in the regulation of actin polymerization. It mediates the formation of branched actin networks and contacts the mother actin filament. Migration and invasion are key processes which enable tumor cells
Aleksandra S Chikina et al.
Biology of the cell, 111(10), 245-261 (2019-08-14)
Metastatic disease is caused by the ability of cancer cells to reach distant organs and form secondary lesions at new locations. Dissemination of cancer cells depends on their migration plasticity - an ability to switch between motility modes driven by

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico