Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU077841

Sigma-Aldrich

MISSION® esiRNA

targeting human LARP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCTACCGAAAGTTTGATGGTGTGGAGGGGCCTCGTACGCCCAAGTACATGAACAACATCACCTACTACTTTGACAATGTCAGCAGCACCGAGCTTTACAGTGTGGATCAGGAACTGCTCAAAGACTACATCAAGCGCCAGATTGAATACTACTTCAGCGTGGACAATTTAGAGCGAGACTTCTTCCTGCGAAGGAAAATGGATGCTGATGGTTTCCTACCCATCACCCTTATTGCTTCCTTCCACCGAGTGCAGGCCCTTACCACTGACATTTCACTCATCTTTGCGGCCCTAAAGGACAGCAAGGTGGTGGAGATCGTTGATGAGAAAGTTCGTAGGAGGGAGGAACCAGAAAAGTGGCCTCTTCCCCCAATAGTGGATTATTCACAGACTGATTTCTCCCAGC

Ensembl | nº de acceso humano

ENSG00000155506

Nº de acceso NCBI

NM_015315

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... LARP1(23367) , LARP1(23367)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
IHT
YET
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Johannes H Wilbertz et al.
Molecular cell, 73(5), 946-958 (2019-01-22)
Biological phase transitions form membrane-less organelles that generate distinct cellular environments. How molecules are partitioned between these compartments and the surrounding cellular space and the functional consequence of this localization is not well understood. Here, we report the localization of
Marie-Laure Plissonnier et al.
Virus research, 271, 197679-197679 (2019-08-10)
Hepatitis C virus (HCV) virions contain a subset of host liver cells proteome often composed of interesting virus-interacting factors. A proteomic analysis performed on double gradient-purified clinical HCV highlighted the translation regulator LARP1 on these virions. This finding was validated
Ewan M Smith et al.
Nucleic acids research, 49(1), 458-478 (2020-12-18)
The mammalian target of rapamycin (mTOR) is a critical regulator of cell growth, integrating multiple signalling cues and pathways. Key among the downstream activities of mTOR is the control of the protein synthesis machinery. This is achieved, in part, via
Maria Dermit et al.
Developmental cell, 55(3), 298-313 (2020-11-11)
Translation of ribosomal protein-coding mRNAs (RP-mRNAs) constitutes a key step in ribosome biogenesis, but the mechanisms that modulate RP-mRNA translation in coordination with other cellular processes are poorly defined. Here, we show that subcellular localization of RP-mRNAs acts as a

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico