Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU077721

Sigma-Aldrich

MISSION® esiRNA

targeting human E2F7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGAAGAGCAAATGGCCTACCTCCAACAGAAAGAGCTGGACCTGATAGATTATAAATTTGGAGAACGTAAAAAAGATGGTGATCCAGATTCCCAGGAACAACAGTTACTGGATTTCTCTGAACCCGACTGTCCCTCTTCATCTGCAAACAGTAGAAAAGACAAGTCTCTGAGAATTATGAGCCAGAAGTTTGTCATGCTGTTCCTCGTCTCCAAAACCAAGATTGTCACTCTGGATGTGGCTGCCAAAATACTGATAGAAGAAAGCCAAGATGCCCCAGACCATAGTAAATTTAAAACAAAGGTACGACGCCTCTATGACATAGCCAATGTTCTGACCAGCTTGGCTCTGATAAAGAAAGTGCATGTAACAGAAGAGCGAGGTCGTAAACCAGCCTTCAAGTGGATC

Ensembl | nº de acceso humano

ENSG00000165891

Nº de acceso NCBI

NM_203394

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... E2F7(144455) , E2F7(144455)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
VGT
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Rui Yang et al.
British journal of cancer, 123(9), 1445-1455 (2020-08-21)
E2F transcription factors are considered to be important drivers of tumour growth. E2F7 is an atypical E2F factor, and its role in glioblastoma remains undefined. E2F7 expression was examined in patients by IHC and qRT-PCR. The overall survival probability was
Weihong Liu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 104, 94-101 (2018-05-18)
Colorectal cancer (CRC) is one of the most common malignancies with high morbidity and mortality rates worldwide. This study aimed to investigate whether miR-3666 was involved in inhibitory effects of all-transretinoic acid (ATRA) on the development of colorectal cancer (CRC).
Hendrika A Segeren et al.
Cell reports, 33(9), 108449-108449 (2020-12-03)
E2F transcription factors control the expression of cell-cycle genes. Cancers often demonstrate enhanced E2F target gene expression, which can be explained by increased percentages of replicating cells. However, we demonstrate in human cancer biopsy specimens that individual neoplastic cells display

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico