Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU077701

Sigma-Aldrich

MISSION® esiRNA

targeting human MALT1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCAAAGGATCTTCCCAAGCATTGCCTCTATACCAGACTCAGTTCACTGCAAAAATTAAAGGAACATCTAGTCTTCACAGTATGTTTATCATATCAGTACTCAGGATTGGAAGATACTGTAGAGGACAAGCAGGAAGTGAATGTTGGGAAACCTCTCATTGCTAAATTAGACATGCATCGAGGTTTGGGAAGGAAGACTTGCTTTCAAACTTGTCTTATGTCTAATGGTCCTTACCAGAGTTCTGCAGCCACCTCAGGAGGAGCAGGGCATTATCACTCATTGCAAGACCCATTCCATGGTGTTTACCATTCACATCCTGGTAATCCAAGTAATGTTACACCAGCAGATAGCTGTCATTGCAGCCGGACTCCAGATGCATTTATTTCAAGTTTCGCTCACCATGCTT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Leonie Konczalla et al.
International journal of cancer, 146(6), 1618-1630 (2019-07-11)
MALT1 is a key mediator of NF-κB signaling and a main driver of B-cell lymphomas. Remarkably, MALT1 is expressed in the majority of pancreatic ductal adenocarcinomas (PDACs) as well, but absent from normal exocrine pancreatic tissue. Following, MALT1 shows off
Matija Hedl et al.
Proceedings of the National Academy of Sciences of the United States of America, 111(37), 13451-13456 (2014-09-10)
Inflammatory diseases are characterized by dysregulated cytokine production. Altered functions for most risk loci, including the inflammatory bowel disease and leprosy-associated tumor necrosis factor ligand superfamily member 15 (TNFSF15) region, are unclear. Regulation of pattern-recognition-receptor (PRR)-induced signaling and cytokines is

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico