Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU076051

Sigma-Aldrich

MISSION® esiRNA

targeting human NOX1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCACAACCTCACCTTCCACAAGCTGGTGGCCTATATGATCTGCCTACATACAGCTATTCACATCATTGCACACCTGTTTAACTTTGACTGCTATAGCAGAAGCCGACAGGCCACAGATGGCTCCCTTGCCTCCATTCTCTCCAGCCTATCTCATGATGAGAAAAAGGGGGGTTCTTGGCTAAATCCCATCCAGTCCCGAAACACGACAGTGGAGTATGTGACATTCACCAGCATTGCTGGTCTCACTGGAGTGATCATGACAATAGCCTTGATTCTCATGGTAACTTCAGCTACTGAGTTCATCCGGAGGAGTTATTTTGAAGTCTTCTGGTATACTCACCACCTTTTTATCTTCTATATCCTTGGCTTAGGGATTCACGGCATTGGTGGAATTGTCCGGGGTCAAACAGAGGAGAGCATGAATGAGAGTCATCCTCGCAAGTGTG

Ensembl | nº de acceso humano

ENSG00000007952

Nº de acceso NCBI

NM_007052

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... NOX1(27035) , NOX1(27035)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
KCU
TRT
QCS
DHT
CWR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Gerco den Hartog et al.
PLoS pathogens, 12(1), e1005382-e1005382 (2016-01-14)
Generation of reactive oxygen species (ROS) during infection is an immediate host defense leading to microbial killing. APE1 is a multifunctional protein induced by ROS and after induction, protects against ROS-mediated DNA damage. Rac1 and NAPDH oxidase (Nox1) are important
Jin-Woo Jeong et al.
International journal of molecular sciences, 20(6) (2019-03-25)
Excessive bone resorption by osteoclasts causes bone loss-related diseases and reactive oxygen species (ROS) act as second messengers in intercellular signaling pathways during osteoclast differentiation. In this study, we explored the protective effects of fermented oyster extract (FO) against receptor
H-P Wang et al.
European review for medical and pharmacological sciences, 20(21), 4474-4481 (2016-11-23)
Reactive oxygen species (ROS) generated by endogenous metabolic enzymes are involved in a variety of pathology processes, including cancer. In particular, superoxide-generating NADPH oxidase 1 (Nox1), a member of Nox enzyme family, is highly expressed in the colon tissue and
The nuclear receptor NOR-1 modulates redox homeostasis in human vascular smooth muscle cells.
Judith Alonso et al.
Journal of molecular and cellular cardiology, 122, 23-33 (2018-08-11)
Mathieu Chocry et al.
Oncotarget, 8(61), 103710-103730 (2017-12-22)
Oxaliplatin is a major treatment for metastatic colorectal cancer, however its effectiveness is greatly diminished by the development of resistances. Our previous work has shown that oxaliplatin efficacy depends on the reactive oxygen species (ROS) produced by Nox1. In this
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico