Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU074371

Sigma-Aldrich

MISSION® esiRNA

targeting human DRD2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAGCTGGAGATGGAGATGCTCTCCAGCACCAGCCCACCCGAGAGGACCCGGTACAGCCCCATCCCACCCAGCCACCACCAGCTGACTCTCCCCGACCCGTCCCACCATGGTCTCCACAGCACTCCCGACAGCCCCGCCAAACCAGAGAAGAATGGGCATGCCAAAGACCACCCCAAGATTGCCAAGATCTTTGAGATCCAGACCATGCCCAATGGCAAAACCCGGACCTCCCTCAAGACCATGAGCCGTAGGAAGCTCTCCCAGCAGAAGGAGAAGAAAGCCACTCAGATGCTCGCCATTGTTCTCGGCGTGTTCATCATCTGCTGGCTGCCCTTCTTCATCACACACATCCTGAACATACACTGTGACTGCAACATCCCGCCTGTCCTGTACAGCGCCTTCACGTGGCTGGGCTATGTCAACAGCGCCGTGAACCCCATCATCTACA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hongli Huang et al.
International immunopharmacology, 39, 113-120 (2016-07-29)
Dopamine (DA), an important neurotransmitter, has been reported to play a negative role in tumor progression. DA acts its role via dopamine receptors (DRs), which can be divided into five receptor subtypes (D1R-D5R). Among these receptor subtypes, D2R has been
Carole Deyts et al.
PloS one, 4(12), e8287-e8287 (2009-12-18)
Huntington's disease (HD) is a polyglutamine-expanded related neurodegenerative disease. Despite the ubiquitous expression of expanded, polyQ-Huntingtin (ExpHtt) in the brain, striatal neurons present a higher susceptibility to the mutation. A commonly admitted hypothesis is that Dopaminergic inputs participate to this
N Shioda et al.
Molecular psychiatry, 22(8), 1205-1222 (2016-12-07)
Aberrant dopamine D
Yanrong Zhang et al.
PloS one, 7(6), e38745-e38745 (2012-06-22)
Renal dopamine receptors participate in the regulation of blood pressure. Genetic factors, including polymorphisms of the dopamine D(2) receptor gene (DRD2) are associated with essential hypertension, but the mechanisms of their contribution are incompletely understood. Mice lacking Drd2 (D(2)-/-) have
Fei Han et al.
Scientific reports, 9(1), 16861-16861 (2019-11-16)
The Wnt/β-catenin pathway is one of the most conserved signaling pathways across species with essential roles in development, cell proliferation, and disease. Wnt signaling occurs at the protein level and via β-catenin-mediated transcription of target genes. However, little is known

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico