Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU073541

Sigma-Aldrich

MISSION® esiRNA

targeting human MGEA5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AACTGCACCTTGTGAATGGTAGTTGAGGTCTTCATACAGTTCAGCCTCTAGAATGGTAACAAATCAGCCAATTGGATTCGAAACAAAGAAGACTATGTAAAACTCACCCATCACACTTTGAGACTACTCACTGGTTGGAAGAATATAGTATTGCAGCAAATCCTGTATGAAAGAGAGATGTGGGCTTCCTTTTTGAGTCTTGTGTTAGGTGCTGAGACCTTTTACATGGGCTTATACAGGGAGAGAGTCTTCAATAAATGTAGTCAGCACTATTTTCTGCATCCAGTGTGGTTGCGTTTCTCACCTGAGAGTAATCAAGATAACATCTGTCATCTTCCTTGGTTTATTGAGTGAAATGCCTCTCAGTCTTAGGGGACATGGCAGAGATGAAAGAAAGAAAGAGTGGGTTTCAGAAGTGTCAGGGTGGAGTGATTCCAAGTGGGATGGTT

Ensembl | nº de acceso humano

ENSG00000198408

Nº de acceso NCBI

NM_012215

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MGEA5(10724) , MGEA5(10724)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Miguel C Lucena et al.
The Journal of biological chemistry, 291(25), 12917-12929 (2016-04-30)
Deregulated cellular metabolism is a hallmark of tumors. Cancer cells increase glucose and glutamine flux to provide energy needs and macromolecular synthesis demands. Several studies have been focused on the importance of glycolysis and pentose phosphate pathway. However, a neglected
Md Ataur Rahman et al.
Oxidative medicine and cellular longevity, 2019, 6279313-6279313 (2019-12-13)
The addition of O-linked β-N-acetylglucosamine (O-GlcNAcylation) to serine and threonine residues is a common posttranslational modification of intracellular proteins which modulates protein functions and neurodegenerative diseases, controlled by a single pair of enzymes, O-GlcNAcase (OGA), and O-GlcNAcylation transferase (OGT). Autophagy
Maïté Leturcq et al.
Cellular and molecular life sciences : CMLS, 75(23), 4321-4339 (2018-08-03)
O-GlcNAcylation of proteins is governed by O-GlcNAc transferase (OGT) and O-GlcNAcase (OGA). The homeostasis of O-GlcNAc cycling is regulated during cell cycle progression and is essential for proper cellular division. We previously reported the O-GlcNAcylation of the minichromosome maintenance proteins
Anupriya Chatterjee et al.
Cells, 9(10) (2020-10-23)
Our previous studies identified that retinal endothelial damage caused by hyperglycemia or nucleoside diphosphate kinase-B (NDPK-B) deficiency is linked to elevation of angiopoietin-2 (Ang-2) and the activation of the hexosamine biosynthesis pathway (HBP). Herein, we investigated how NDPK-B is involved

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico