Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU071861

Sigma-Aldrich

MISSION® esiRNA

targeting human APLN

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGTTTTCAGGAGCTCTGGTGAAGTGGGTGGAGCATCAGCGTTTGCTCAGTTAAGGGAGAGGTAGAGAGGGGCCCGTGAAGTCCTTTGTCACTTCTCTTGCCTTAGTGTGCCTCCCAATACTCCCTTCTTCCTGCCCCCACACCCCATCCCCAGCTAGCCCAAGCTCCAGGTCAGGAGGGGAGGGTGCTGGGCCTGACATGGCTATATACCCTCCCAGGAGTAAAAGCCAAGCAAGAGGTTGTTTTTGCCAAGAATCACAGAATGTTAGAGCTGACAGGACCCTTGAAGGTCACTTAGCCTTCTTAGGCAAACGCCTGCAAAACAGAAGCCTGGAGAGGGGAGTGACCTGCTCAGAGTCATTGCAGAGCCGGGATGGGGACCAGGTCTCCCATCTCCTACTTTATGACGCC

Ensembl | nº de acceso humano

ENSG00000171388

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... APLN(8862) , APLN(8862)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
DZU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yoko Yokoyama et al.
Arthritis & rheumatology (Hoboken, N.J.), 70(10), 1661-1672 (2018-04-21)
Apelin/APJ signaling has been determined to regulate cardiac and arterial fibrosis and to be involved in the pathogenesis of pulmonary arterial hypertension. Our objective was to elucidate the role of apelin in skin fibrosis in systemic sclerosis (SSc). Expression of
Aung Than et al.
The Journal of biological chemistry, 290(23), 14679-14691 (2015-05-02)
Brown adipose tissue expends energy in the form of heat via the mitochondrial uncoupling protein UCP1. Recent studies showed that brown adipose tissue is present in adult humans and may be exploited for its anti-obesity and anti-diabetes actions. Apelin is

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico