Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU070211

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPC1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTTGGAAAATTTCTTGGGATGTTTCTTCTTGTTTTGTTTTCTTTCACAATTGGACTGACACAACTGTATGATAAAGGATATACTTCAAAGGAGCAGAAGGACTGTGTAGGCATCTTCTGTGAACAGCAAAGCAATGATACCTTCCATTCGTTCATTGGCACCTGCTTTGCTTTGTTCTGGTATATTTTCTCCTTAGCGCATGTGGCAATCTTTGTCACAAGATTTAGCTATGGAGAAGAACTGCAGTCCTTTGTGGGAGCTGTCATTGTTGGTACATACAATGTCGTGGTTGTGATTGTGCTTACCAAACTGCTGGTGGCAATGCTTCATAAAAGCTTTCAGTTGATAGCAAATCATGAAGACAAAGAATGGAAGTTTGCTCGAGCAAAATTATGGCTTAGCTACTTTGATGACAAATGTACGTTACCTCCACCTTTCAACATCATTCCCTCACCA

Ensembl | nº de acceso humano

ENSG00000144935

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TRPC1(7220) , TRPC1(7220)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qinqin Pu et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(1), 1074-1085 (2018-08-02)
Airway remodeling with progressive epithelial alterations in the respiratory tract is a severe consequence of asthma. Although dysfunctional signaling transduction is attributed to airway inflammation, the exact mechanism of airway remodeling remains largely unknown. TRPC1, a member of the transient
Corena V Grant et al.
Breast cancer research and treatment, 177(2), 345-355 (2019-06-24)
Triple-negative breast cancers (TNBCs) represent a heterogeneous group of tumors. The lack of targeted therapies combined with the inherently aggressive nature of TNBCs results in a higher relapse rate and poorer overall survival. We evaluated the heterogeneity of TNBC cell
Xiaoyu Zhang et al.
Journal of cellular biochemistry, 119(7), 6033-6044 (2018-03-27)
This study aimed to validate whether transient receptor potential channel1 (TRPC1) and TRPC3 participate in the regulation the proliferation of airway smooth muscle cells (ASMCs) through modulating calcium ion (Ca2+ ) influx in vitro. Chronic model of murine asthma was
Michael F Emmons et al.
Scientific reports, 7(1), 2685-2685 (2017-06-05)
The emergence of drug resistance continues to be a major hurdle towards improving patient outcomes for the treatment of Multiple Myeloma. MTI-101 is a first-in-class peptidomimetic that binds a CD44/ITGA4 containing complex and triggers necrotic cell death in multiple myeloma
Yuyang Sun et al.
Journal of cellular physiology, 230(11), 2848-2856 (2015-04-23)
Calcium-activated chloride channel (CaCC) plays an important role in modulating epithelial secretion. It has been suggested that in salivary tissues, sustained fluid secretion is dependent on Ca(2+) influx that activates ion channels such as CaCC to initiate Cl(-) efflux. However

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico