Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU069871

Sigma-Aldrich

MISSION® esiRNA

targeting human NRF1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAGTGACCCAAACCGAACATATGGCTACCATAGAAGCACATGCAGTGGCCCAGCAAGTGCAGCAGGTCCATGTGGCTACTTACACCGAGCATAGTATGCTGAGTGCTGATGAAGACTCGCCTTCTTCTCCCGAGGACACCTCTTACGATGACTCAGATATACTCAACTCCACAGCAGCTGATGAGGTGACAGCTCATCTGGCAGCTGCAGGTCCTGTGGGAATGGCCGCTGCTGCTGCTGTGGCAACAGGAAAGAAACGGAAACGGCCTCATGTATTTGAGTCTAATCCATCTATCCGGAAGAGGCAACAAACACGTTTGCTTCGGAAACTTCGAGCCACGTTAGATGAATATACTACTCGTGTGGGACAGCAAGCTATTGTCCTCTGTATCTCACCCTCCAAACCTAACCCTGTCTTTAAAGTGTTTGGTGCAGCACCTTTGGAGAATGTGGTGC

Ensembl | nº de acceso humano

ENSG00000106459

Nº de acceso NCBI

NM_005011

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... NRF1(4899) , NRF1(4899)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Victoria Sid et al.
Journal of molecular medicine (Berlin, Germany), 96(11), 1203-1213 (2018-09-05)
Folate is an essential micronutrient for biological function. The liver, a primary organ for folate metabolism and storage, plays an important role in folate homeostasis. Proton-coupled folate transporter (PCFT) and reduced folate carrier (RFC) are the major folate transporters responsible
Luqing Zhao et al.
Oncotarget, 6(18), 15995-16018 (2015-07-24)
microRNAs (miRNAs) are involved in the various processes of DNA damage repair and play crucial roles in regulating response of tumors to radiation therapy. Here, we used nasopharyngeal carcinoma (NPC) radio-resistant cell lines as models and found that the expression
V O Okoh et al.
British journal of cancer, 112(10), 1687-1702 (2015-05-13)
17β-Oestradiol (E2)-induced reactive oxygen species (ROS) have been implicated in regulating the growth of breast cancer cells. However, the underlying mechanism of this is not clear. Here we show how ROS through a novel redox signalling pathway involving nuclear respiratory

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico