Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU069741

Sigma-Aldrich

MISSION® esiRNA

targeting human POSTN

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AATCATCCATGGGAACCAGATTGCAACAAATGGTGTTGTCCATGTCATTGACCGTGTGCTTACACAAATTGGTACCTCAATTCAAGACTTCATTGAAGCAGAAGATGACCTTTCATCTTTTAGAGCAGCTGCCATCACATCGGACATATTGGAGGCCCTTGGAAGAGACGGTCACTTCACACTCTTTGCTCCCACCAATGAGGCTTTTGAGAAACTTCCACGAGGTGTCCTAGAAAGGATCATGGGAGACAAAGTGGCTTCCGAAGCTCTTATGAAGTACCACATCTTAAATACTCTCCAGTGTTCTGAGTCTATTATGGGAGGAGCAGTCTTTGAGACGCTGGAAGGAAATACAATTGAGATAGGATGTGACGGTGACAGTATAACAGTAAATGGAATCAAAATGGTGAACAAAAAGGATATTGTGACAAATAATGGTGTGATCCATTTGATTGA

Ensembl | nº de acceso humano

ENSG00000133110

Nº de acceso NCBI

NM_006475

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... POSTN(10631) , POSTN(10631)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
VZU
LQU
ZZS
CWS
ZQS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

A Tomaru et al.
Gene therapy, 24(11), 706-716 (2017-08-19)
Idiopathic pulmonary fibrosis (IPF) is a fatal disease with a median survival of 3-4 years after diagnosis. It is the most frequent form of a group of interstitial pneumonias of unknown etiology. Current available therapies prevent deterioration of lung function
Yujin Liu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 88, 342-348 (2017-01-26)
Hypoxia has been suggested to induce chemoresistance in tumor cells. In this study, we aimed to test the hypothesis that hypoxia-inducible factor-1alpha (HIF-1α)/periostin axis might promote arsenic trioxide resistance in hepatocellular carcinoma (HCC) cells under hypoxia. HCC cells were exposed
Jae Eun Um et al.
Scientific reports, 7(1), 8490-8490 (2017-08-19)
Diabetic nephropathy, the major cause of chronic kidney disease, is associated with progressive renal fibrosis. Recently, accumulation of periostin, an extracellular matrix protein, was shown to augment renal fibrosis. Aptamers have higher binding affinities without developing the common side effects
Xiting Han et al.
Journal of cellular physiology, 234(8), 14170-14180 (2019-01-12)
The human cervical cancer (CC) has been identified as one of the most common tumors in women, and the molecular regulation in CC still remains unclear. The dysregulation of periostin has been found in a variety of cancers, but whether
Xiaofan Guo et al.
Oncotarget, 7(49), 80521-80542 (2016-09-08)
Tumor-associated macrophages (TAMs) are enriched in gliomas and help create a tumor-immunosuppressive microenvironment. A distinct M2-skewed type of macrophages makes up the majority of glioma TAMs, and these cells exhibit pro-tumor functions. Gliomas contain large hypoxic areas, and the presence
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico