Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU067781

Sigma-Aldrich

MISSION® esiRNA

targeting human PDLIM5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCCATTGTAACCAGGTCATCAGAGGACCATTCTTAGTGGCACTGGGGAAATCTTGGCACCCAGAAGAATTCAACTGCGCTCACTGCAAAAATACAATGGCCTACATTGGATTTGTAGAGGAGAAAGGAGCCCTGTATTGTGAGCTGTGCTATGAGAAATTCTTTGCCCCTGAATGTGGTCGATGCCAAAGGAAGATCCTTGGAGAAGTCATCAGTGCGTTGAAACAAACTTGGCATGTTTCCTGTTTTGTGTGTGTAGCCTGTGGAAAGCCCATTCGGAACAATGTTTTTCACTTGGAGGATGGTGAACCCTACTGTGAGACTGATTATTATGCCCTCTTTGGTACTATATGCCATGGATGTGAATTTCCCATAGAAGCTGGTGACATGTTCCTGGAAGCTCTGGGCTACAC

Ensembl | nº de acceso humano

ENSG00000163110

Nº de acceso NCBI

NM_006457

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PDLIM5(10611) , PDLIM5(10611)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Han Cheng et al.
Journal of biomolecular screening, 21(4), 333-341 (2016-01-15)
Pulmonary arterial hypertension is a complex disease with multiple etiologic factors. PDLIM5, a member of the Enigma subfamily of PDZ and LIM domain protein family, contains an N-terminal PDZ domain and three LIM domains at its C-terminus. We have previously
Xiaodan Wei et al.
Biochemical and biophysical research communications, 499(2), 338-344 (2018-03-27)
In order to better understand the mechanisms underlying the development of papillary thyroid carcinoma (PTC), and to identify new potential biomarkers, high-resolution label-free mass spectrometry was performed on PTC tissues and adjacent normal thyroid tissues from six patients. In this

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico