Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU067301

Sigma-Aldrich

MISSION® esiRNA

targeting human TFCP2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACAACCACACCTCAGGAAGCTCAGCAGTGGTTGCATCGAAATCGTTTTTCTACATTCACAAGGCTTTTCACAAACTTCTCAGGGGCAGATTTATTGAAATTAACTAGAGATGATGTGATCCAAATCTGTGGCCCTGCAGATGGAATCAGACTTTTTAATGCATTAAAAGGCCGGATGGTGCGTCCAAGGTTAACCATTTATGTTTGTCAGGAATCACTGCAGTTGAGGGAGCAGCAACAACAGCAGCAGCAACAGCAGCAGAAGCATGAGGATGGAGACTCAAATGGTACTTTCTTCGTTTACCATGCTATCTATCTAGAAGAACTAACAGCTGTTGAATTGACAGAAAAAATTGCTCAGCTTTTCAGCATTTCCCCTTGCCAGATCAGCCAGATTTACAAGCAGGGGCCAAC

Ensembl | nº de acceso humano

ENSG00000135457

Nº de acceso NCBI

NM_005653

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TFCP2(7024) , TFCP2(7024)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
CDV
FRT
ZNS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shi Wang et al.
Acta biochimica et biophysica Sinica, 48(12), 1085-1093 (2016-11-01)
Pancreatic cancer is an aggressive malignancy. The median survival rate remains low, indicating that the identification of novel biomarkers and therapeutic targets is critical. Here, we examined the role of microRNA-182 (miR-182) in pancreatic cancer development. Analysis of human pancreatic
Kedarlal Sharma et al.
Journal of molecular neuroscience : MN, 65(3), 343-350 (2018-07-12)
MeCP2 (methyl-CpG binding protein 2), an epigenetic regulator, has been shown to regulate the function of neurons and glial cells. Our previous study has demonstrated that MeCP2 repress the myelin gene expression in rat oligodendrocytes but whether MeCP2 bind to
Arpita Dave et al.
Journal of molecular neuroscience : MN, 67(1), 16-27 (2018-12-07)
Astrocytes play the central role in CNS metabolism to support neuronal functions. Mehyl-CpG-binding protein 2 (MeCP2) is the global transcription factor with differential expression in neuronal and non-neuronal cells. MeCP2 mutation and downstream detrimental effects have been reported in astrocytes
Jiawei Zhou et al.
Cell death & disease, 8(2), e2597-e2597 (2017-02-10)
Mammalian folliculogenesis is a complex process in which primordial follicles develop into pre-ovulatory follicles, followed by ovulation to release mature oocytes. In this study, we explored the role of miR-144 in ovulation. miR-144 was one of the differentially expressed microRNAs
Buch Lipi et al.
Experimental brain research, 236(11), 3015-3027 (2018-08-18)
Astrocytes perform several critical functions such as promoting neuronal maturation, neuronal survival, maintaining and supporting neurons and oligodendrocytes. Astrocytes participate in the formation of nodes of Ranvier. Recently, studies emphasizing on the role of astrocytes in regulating myelination by secreting

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico