Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU066371

Sigma-Aldrich

MISSION® esiRNA

targeting human CARM1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCATGGGCTACATGCTCTTCAACGAGCGCATGCTGGAGAGCTACCTCCACGCCAAGAAGTACCTGAAGCCCAGCGGAAACATGTTTCCTACCATTGGTGACGTCCACCTTGCACCCTTCACGGATGAACAGCTCTACATGGAGCAGTTCACCAAGGCCAACTTCTGGTACCAGCCATCTTTCCATGGAGTGGACCTGTCGGCCCTCCGAGGTGCCGCGGTGGATGAGTATTTCCGGCAGCCTGTGGTGGACACATTTGACATCCGGATCCTGATGGCCAAGTCTGTCAAGTACACGGTGAACTTCTTAGAAGCCAAAGAAGGAGATTTGCACAGGATAGAAATCCCATTCAAATTCCACATGCTGCATTCAGGGCTGGTCCACGGCCTGGCTTTCTGGTTTGACGTTGCTTTCA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qiongjie Cao et al.
Eye and vision (London, England), 7, 35-35 (2020-08-09)
MicroRNAs (miRNAs) play critical roles in corneal development and functional homeostasis. Our previous study identified miR-184 as one of the most highly expressed miRNAs in the corneal epithelium. Even though its expression level plummeted dramatically during corneal epithelial wound healing
Cynthia M Quintero et al.
Journal of molecular biology, 430(21), 4168-4182 (2018-08-29)
Activation of the retinoic acid (RA) signaling pathway is important for controlling embryonic stem cell differentiation and development. Modulation of this pathway occurs through the recruitment of different epigenetic regulators at the retinoic acid receptors (RARs) located at RA-responsive elements
Priyanka Sharma et al.
Molecular cell, 73(1), 84-96 (2018-11-26)
The post-translational modification of key residues at the C-terminal domain of RNA polymerase II (RNAP2-CTD) coordinates transcription, splicing, and RNA processing by modulating its capacity to act as a landing platform for a variety of protein complexes. Here, we identify
Dongil Kim et al.
Cellular signalling, 26(9), 1774-1782 (2014-04-15)
Podocyte apoptosis induced by hyperglycemia is considered a critical factor in the development of diabetic nephropathy. Recent studies have implicated Notch signaling in podocyte apoptosis; however, its regulatory mechanisms are not fully understood. In this study, we found that high-glucose

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico