Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU065091

Sigma-Aldrich

MISSION® esiRNA

targeting human LAMP2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CACCACTGTGCCATCTCCTACTACAACACCTACTCCAAAGGAAAAACCAGAAGCTGGAACCTATTCAGTTAATAATGGCAATGATACTTGTCTGCTGGCTACCATGGGGCTGCAGCTGAACATCACTCAGGATAAGGTTGCTTCAGTTATTAACATCAACCCCAATACAACTCACTCCACAGGCAGCTGCCGTTCTCACACTGCTCTACTTAGACTCAATAGCAGCACCATTAAGTATCTAGACTTTGTCTTTGCTGTGAAAAATGAAAACCGATTTTATCTGAAGGAAGTGAACATCAGCATGTATTTGGTTAATGGCTCCGTTTTCAGCATTGCAAATAACAATCTCAGCTACTGGGATGCCCCCCTGGGAAGTTCTTATATGTGCAACAAAGAGCAGACTGTTTCAGTGTCTGGAGCATTTCAGATAAATACCTTTGATCTAAGGGTTCAGCCTTTCAATGTGA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Anne-Sophie Bach et al.
Oncotarget, 6(29), 28084-28103 (2015-07-18)
The lysosomal protease cathepsin D (Cath-D) is overproduced in breast cancer cells (BCC) and supports tumor growth and metastasis formation. Here, we describe the mechanism whereby Cath-D is accumulated in the nucleus of ERα-positive (ER+) BCC. We identified TRPS1 (tricho-rhino-phalangeal-syndrome
Vikash Singh et al.
The Journal of biological chemistry, 292(5), 1847-1864 (2016-12-10)
Salmonella enterica are invasive intracellular pathogens that replicate within a membrane-bound compartment inside infected host cells known as the Salmonella-containing vacuole. How Salmonella obtains nutrients for growth within this intracellular niche despite the apparent isolation is currently not known. Recent
Chuan-Ying Xu et al.
Frontiers in aging neuroscience, 9, 308-308 (2017-10-13)
α-Synuclein misfolding and aggregation play an important role in the pathogenesis of Parkinson's disease (PD). Loss of function and mutation of the PARK7/DJ-1 gene cause early-onset familial PD. DJ-1 can inhibit α-synuclein aggregation, and may function at an early step
Anders P Mutvei et al.
Nature communications, 11(1), 1416-1416 (2020-03-19)
The kinase mTOR complex 1 (mTORC1) promotes cellular growth and is frequently dysregulated in cancers. In response to nutrients, mTORC1 is activated on lysosomes by Rag and Rheb guanosine triphosphatases (GTPases) and drives biosynthetic processes. How limitations in nutrients suppress

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico