Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU064111

Sigma-Aldrich

MISSION® esiRNA

targeting human ASAH1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGATTCAAACCAGGACTGTTCAGTCTTACACTGAATGAACGTTTCAGTATAAATGGTGGTTATCTGGGTATTCTAGAATGGATTCTGGGAAAGAAAGATGTCATGTGGATAGGGTTCCTCACTAGAACAGTTCTGGAAAATAGCACAAGTTATGAAGAAGCCAAGAATTTATTGACCAAGACCAAGATATTGGCCCCAGCCTACTTTATCCTGGGAGGCAACCAGTCTGGGGAAGGTTGTGTGATTACACGAGACAGAAAGGAATCATTGGATGTATATGAACTCGATGCTAAGCAGGGTAGATGGTATGTGGTACAAACAAATTATGACCGTTGGAAACATCCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCCAAGAGAATATCTCATTTGAAACCATGTATGATGTCCTGTCAACAAAACCTGTCCTCAACAAGCTGACCGT

Ensembl | nº de acceso humano

ENSG00000104763

Nº de acceso NCBI

NM_004315

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ASAH1(427) , ASAH1(427)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
LWU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Su-Fern Tan et al.
Journal of lipid research, 60(6), 1078-1086 (2019-04-10)
Acute myeloid leukemia (AML) is the most common acute leukemia in adults. More than half of older AML patients fail to respond to cytotoxic chemotherapy, and most responders relapse with drug-resistant disease. Failure to achieve complete remission can be partly
Su-Fern Tan et al.
Oncotarget, 7(50), 83208-83222 (2016-11-09)
There is an urgent unmet need for new therapeutics in acute myeloid leukemia (AML) as standard therapy has not changed in the past three decades and outcome remains poor for most patients. Sphingolipid dysregulation through decreased ceramide levels and elevated
Jennifer M Pearson et al.
Molecular cancer research : MCR, 18(3), 352-363 (2019-11-21)
Acute myeloid leukemia (AML) is a disease characterized by uncontrolled proliferation of immature myeloid cells in the blood and bone marrow. The 5-year survival rate is approximately 25%, and recent therapeutic developments have yielded little survival benefit. Therefore, there is

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico