Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU063551

Sigma-Aldrich

MISSION® esiRNA

targeting human CUL3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGTGATGCACTGCCTTGACAAATCAACGGAAGAACCAATTGTAAAGGTGGTTGAAAGGGAACTCATTTCCAAGCACATGAAGACTATAGTAGAAATGGAGAATTCTGGGCTAGTACATATGTTGAAAAATGGAAAGACAGAAGACCTTGGTTGCATGTACAAGTTATTTAGTCGTGTGCCAAATGGTTTGAAAACAATGTGTGAGTGTATGAGTTCCTATTTGAGGGAGCAAGGTAAAGCTCTTGTTTCTGAAGAAGGAGAAGGAAAGAATCCTGTTGACTATATCCAGGGCTTATTGGATCTGAAGAGTAGGTTCGATCGCTTCCTCCTGGAATCATTCAACAATGACCGTCTCTTTAAACAAACTATTGCGGGTGACTTTGAGTATTTTCTCAACCTCAACTCCAGGTCTCCTG

Ensembl | nº de acceso humano

ENSG00000036257

Nº de acceso NCBI

NM_003590

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CUL3(8452) , CUL3(8452)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tomohisa Sakaue et al.
Cancer science, 108(2), 208-215 (2016-12-18)
Vascular endothelial (VE)-cadherin, a major endothelial adhesion molecule, regulates vascular permeability, and increased vascular permeability has been observed in several cancers. The aim of this study was to elucidate the role of the NEDD8-Cullin E3 ligase, in maintaining barrier permeability.
Tomohisa Sakaue et al.
Scientific reports, 7, 42845-42845 (2017-02-22)
Vascular endothelial cell growth factor receptor 2 (VEGFR2) is an essential receptor for the homeostasis of endothelial cells. In this study, we showed that NEDD8-conjugated Cullin3 (CUL3)-based ubiquitin E3 (UbE3) ligase plays a crucial role in VEGFR2 mRNA expression. Human
Alexandros P Drainas et al.
Cell reports, 31(1), 107465-107465 (2020-04-09)
TP53 deficiency is the most common alteration in cancer; however, this alone is typically insufficient to drive tumorigenesis. To identify genes promoting tumorigenesis in combination with TP53 deficiency, we perform genome-wide CRISPR-Cas9 knockout screens coupled with proliferation and transformation assays
Antonio Pisano et al.
The Journal of biological chemistry, 290(22), 13958-13971 (2015-04-18)
The human inhibitor of Bruton's tyrosine kinase isoform α (IBtkα) is a BTB protein encoded by the IBTK gene, which maps to chromosomal locus 6q14.1, a mutational hot spot in lymphoproliferative disorders. Here, we demonstrate that IBtkα forms a CRL3(IBTK)
Qian Zhang et al.
Reproduction (Cambridge, England), 150(2), 139-149 (2015-05-30)
Cullin 3 (CUL3), a scaffold protein, assembles a large number of ubiquitin ligase complexes, similar to Skp1-Cullin 1-F-box protein complex. Several genetic models have shown that CUL3 is crucial for early embryonic development. Nevertheless, the role of CUL3 in human

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico