Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU063441

Sigma-Aldrich

MISSION® esiRNA

targeting human PACSIN2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAGGAAGACGCAGAACAACAGAAATAGCCGCCCCTCCCCGCCCACTGTGCCTGTTGGCCTATCATAGATCTCTATGTTCTTGACTTTGTCTCTCCTTTCCGAGTCAATGGTGGGTTACACTGATCTTGTTCCACTGATTACTCTCTCTGACGAGTCCATCACCTGCAACTTAAATGAACAAGCTTACATCCCATTTTGAGTGAAGATTTTGAGGTTTTTAATTTAAAGGCTGTGTACAGTTATACTTTTTTATACACCTGTTCATTTCTACTTAAATTATGGCACAGATTGATGCGCACCAGTCTTGAGGAAACGATCTCCCTATTCCCTTACCCTGTTACTCAGCCACGCCGTGTGTAGGCTTAGCCTCAGGTGGCAGATGTTTGAGGAAAGGAATTATGCCAGGAAGGTGGGACCGGGTTATGGTCGGGTTTCTATTGGGAATGCTCTTTGTGCTTTTGGGCATCTGAAT

Ensembl | nº de acceso humano

ENSG00000100266

Nº de acceso NCBI

NM_007229

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PACSIN2(11252) , PACSIN2(11252)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaohe Tian et al.
Science advances, 6(48) (2020-11-29)
The blood-brain barrier is made of polarized brain endothelial cells (BECs) phenotypically conditioned by the central nervous system (CNS). Although transport across BECs is of paramount importance for nutrient uptake as well as ridding the brain of waste products, the
Meagan M Postema et al.
Molecular biology of the cell, 30(19), 2515-2526 (2019-08-08)
Apical microvilli are critical for the homeostasis of transporting epithelia, yet mechanisms that control the assembly and morphology of these protrusions remain poorly understood. Previous studies in intestinal epithelial cell lines suggested a role for the F-BAR domain protein PACSIN2

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico