Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU062901

Sigma-Aldrich

MISSION® esiRNA

targeting human CHD4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GATGCTGACGCATCTAGTGGTGCGGCCTGGGCTGGGCTCCAAGACTGGATCTATGTCCAAACAGGAGCTTGATGATATCCTCAAATTTGGCACTGAGGAACTATTCAAGGATGAAGCCACTGATGGAGGAGGAGACAACAAAGAGGGAGAAGATAGCAGTGTTATCCACTACGATGATAAGGCCATTGAACGGCTGCTAGACCGTAACCAGGATGAGACTGAAGACACAGAATTGCAGGGCATGAATGAATATTTGAGCTCATTCAAAGTGGCCCAGTATGTGGTACGGGAAGAAGAAATGGGGGAGGAAGAGGAGGTAGAACGGGAAATCATTAAACAGGAAGAAAGTGTGGATCCTGACTACTGGGAGAAATTGCTGCGGCACCATTATGAGCAGCAGCAAGAAGATCTAGCCCG

Ensembl | nº de acceso humano

ENSG00000111642

Nº de acceso NCBI

NM_001273

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CHD4(1108) , CHD4(1108)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
ZYU
WUT
FQR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Poyil Pratheeshkumar et al.
International journal of molecular sciences, 22(2) (2021-01-10)
Chromodomain-helicase-DNA-binding protein 4 (CHD4), a core subunit of the nucleosome remodeling and deacetylation (NuRD) complex is highly expressed in several cancers. However, its role in the pathogenesis and progression of papillary thyroid carcinoma (PTC) has not been investigated. We investigated
Zhongliang Zhao et al.
Nucleic acids research, 44(17), 8144-8152 (2016-06-04)
Attenuation of ribosome biogenesis in suboptimal growth environments is crucial for cellular homeostasis and genetic integrity. Here, we show that shutdown of rRNA synthesis in response to elevated temperature is brought about by mechanisms that target both the RNA polymerase
Artem K Velichko et al.
Nucleic acids research, 47(13), 6811-6825 (2019-05-23)
The contribution of nucleoli to the cellular stress response has been discussed for over a decade. Stress-induced inhibition of RNA polymerase I-dependent transcription is hypothesized as a possible effector program in such a response. In this study, we report a

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico