Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU061931

Sigma-Aldrich

MISSION® esiRNA

targeting human RBCK1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGACCCCTGAGGATTACCAGCGATTTCTAGACCTGGGCATCTCCATTGCTGAAAACCGCAGTGCCTTCAGCTACCATTGCAAGACCCCAGATTGCAAGGGATGGTGCTTCTTTGAGGATGATGTCAATGAGTTCACCTGCCCTGTGTGTTTCCACGTCAACTGCCTGCTCTGCAAGGCCATCCATGAGCAGATGAACTGCAAGGAGTATCAGGAGGACCTGGCCCTGCGGGCTCAGAACGATGTGGCTGCCCGGCAGACGACAGAGATGCTGAAGGTGATGCTGCAGCAGGGCGAGGCCATGCGCTGCCCCCAGTGCCAGATCGTGGTACAGAAGAAGGACGGCTGCGACTGGATCCGCTGCACCGTCTGCCACACCGAGATCTGCTGGGTCACCAAGGGCCCACGCTGGGGCCCTGGGGGCCCAGGAGACACCAGCGGGGGCTGCCGCTGCAGGGTAAATGGGATTCCTTGCCA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Theo Klein et al.
Nature communications, 6, 8777-8777 (2015-11-04)
Antigen receptor signalling activates the canonical NF-κB pathway via the CARD11/BCL10/MALT1 (CBM) signalosome involving key, yet ill-defined roles for linear ubiquitination. The paracaspase MALT1 cleaves and removes negative checkpoint proteins, amplifying lymphocyte responses in NF-κB activation and in B-cell lymphoma
C Donley et al.
Oncogene, 33(26), 3441-3450 (2013-08-06)
FKBPL has been implicated in processes associated with cancer, including regulation of tumor growth and angiogenesis with high levels of FKBPL prognosticating for improved patient survival. Understanding how FKBPL levels are controlled within the cell is therefore critical. We have
Julia Zinngrebe et al.
The Journal of experimental medicine, 213(12), 2671-2689 (2016-11-05)
The linear ubiquitin chain assembly complex (LUBAC), consisting of SHANK-associated RH-domain-interacting protein (SHARPIN), heme-oxidized IRP2 ubiquitin ligase-1 (HOIL-1), and HOIL-1-interacting protein (HOIP), is a critical regulator of inflammation and immunity. This is highlighted by the fact that patients with perturbed

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico