Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU061741

Sigma-Aldrich

MISSION® esiRNA

targeting human BECN1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCTGAGAGACTGGATCAGGAGGAAGCTCAGTATCAGAGAGAATACAGTGAATTTAAACGACAGCAGCTGGAGCTGGATGATGAGCTGAAGAGTGTTGAAAACCAGATGCGTTATGCCCAGACGCAGCTGGATAAGCTGAAGAAAACCAACGTCTTTAATGCAACCTTCCACATCTGGCACAGTGGACAGTTTGGCACAATCAATAACTTCAGGCTGGGTCGCCTGCCCAGTGTTCCCGTGGAATGGAATGAGATTAATGCTGCTTGGGGCCAGACTGTGTTGCTGCTCCATGCTCTGGCCAATAAGATGGGTCTGAAATTTCAGAGATACCGACTTGTTCCTTACGGAAACCATTCATATCTGGAGTCTCTGACAGACAAATCTAAGGAGCTGCCGTTATACTGTTCTGGGGGGTTGCGGTTTTTCTGGGACAACAAGTTTGACCATGCAATGGTGGCTTTCCTGGACTGTGTGCAG

Ensembl | nº de acceso humano

ENSG00000126581

Nº de acceso NCBI

NM_003766

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... BECN1(8678) , BECN1(8678)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
UBV
TTU
TOU
BOU
IYT

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Guangmin Xi et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 84, 1610-1616 (2016-11-09)
Multidrug resistance (MDR) is a major obstacle for successful chemotherapy treatment. Searching for effective MDR modulators and combining them with anticancer drug therapies has been a promising strategy against clinical MDR. In our previous study, we have found that DHA-E3
Haoran Peng et al.
Viruses, 10(5) (2018-05-16)
Autophagy is a common strategy for cell protection; however, some viruses can in turn adopt cellular autophagy to promote viral replication. Zika virus (ZIKV) is the pathogen that causes Zika viral disease, and it is a mosquito-borne virus. However, its
Jingjing Wu et al.
Journal of cellular and molecular medicine, 22(2), 1190-1201 (2017-10-28)
Long-term peritoneal dialysis is accompanied by functional and histopathological alterations in the peritoneal membrane. In the long process of peritoneal dialysis, high-glucose peritoneal dialysis solution (HGPDS) will aggravate the peritoneal fibrosis, leading to decreased effectiveness of peritoneal dialysis and ultrafiltration
Peiye Song et al.
Journal of experimental & clinical cancer research : CR, 38(1), 354-354 (2019-08-16)
Estrogen receptor β (ERβ) has been reported to play an anti-cancer role in breast cancer, but the regulatory mechanism by which ERβ exerts this effect is not clear. Claudin-6 (CLDN6), a tight junction protein, acts as a tumor suppressor gene
Wenkang Luan et al.
OncoTargets and therapy, 10, 4569-4577 (2017-10-27)
Autophagy is not only a survival response to growth-factor or nutrient deprivation but also an important mechanism for tumor-cell suicide, including melanoma.
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico