Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU060941

Sigma-Aldrich

MISSION® esiRNA

targeting human MXI1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCAGTGCAGTTGAGTTGTGTGTTAATGTTAGACTATCCCTTTGTGAGTGACACTTTAACAGCATTCACTGCTTCTATATATAGTGTACCATCTTGGTCATACATTACGCCTCAACATATACTTGTGCTCTTCCTTTGCCTCCAGAAGAAGTTTTTCCTTGATTGTGCTATGTTTCAGTGGAAGAAATTCTTTGAAGTAGATGTGAGTGAAAAACTGCATGCCTTTAGAAGCCCAGTATCAGAACTTGCTACGTTTCAGGTGCTAGGGACTTAATGAAAAACAGGACAAAACAATTCCTTTTTGTGGCCCAGGTAAATTATTTCTGGTTTCACTTATAATTACTAATGGCTGAGTCAAGATGTTGTCTCTGTGTTTGCTTACTCTTGATCAAGTGTGAGACAGTTTGAAGACTGTGCTACCATACAAAGTGAATGAAGCCAGTGACTAAGCTTCTGTTTGTTTTGTTATTCTCATGGCCTTCGCT

Ensembl | nº de acceso humano

ENSG00000119950

Nº de acceso NCBI

NM_001008541

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MXI1(4601) , MXI1(4601)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jianwen Zhou et al.
PloS one, 8(12), e83055-e83055 (2014-01-01)
Gliomas are the most common and aggressive primary tumors in the central nervous system. Recently, Max interactor-1 (MXI1), an antagonist of c-Myc that is involved in brain tumor progression, has been reported to be deregulated in a variety of tumors
Stacie E Dodgson et al.
Genes & development, 30(20), 2259-2271 (2016-11-04)
Aneuploidy-or an unbalanced karyotype in which whole chromosomes are gained or lost-causes reduced fitness at both the cellular and organismal levels but is also a hallmark of human cancers. Aneuploidy causes a variety of cellular stresses, including genomic instability, proteotoxic
Xingkang Wu et al.
Biochemical and biophysical research communications, 499(4), 927-933 (2018-04-08)
Colorectal cancer (CRC) is the third most prevalent malignancy worldwide. New understandings about this disease are urgently required to guide clinical therapies. In this study, we focused on the effects of the small molecule PMN on CRC cells. PMN dose-dependently
Ana Vanessa Nascimento et al.
Acta biomaterialia, 47, 71-80 (2016-10-19)
Efficiency of chemotherapy is often limited by low therapeutic index of the drug as well as emergence of inherent and acquired drug resistance in cancer cells. As a common strategy to overcome drug resistance, higher doses of chemo-agents are administered.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico