Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU060821

Sigma-Aldrich

MISSION® esiRNA

targeting human PCSK9

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAGGCATTCAATCCTCAGGTCTCCACCAAGGAGGCAGGATTCTTCCCATGGATAGGGGAGGGGGCGGTAGGGGCTGCAGGGACAAACATCGTTGGGGGGTGAGTGTGAAAGGTGCTGATGGCCCTCATCTCCAGCTAACTGTGGAGAAGCCCCTGGGGGCTCCCTGATTAATGGAGGCTTAGCTTTCTGGATGGCATCTAGCCAGAGGCTGGAGACAGGTGCGCCCCTGGTGGTCACAGGCTGTGCCTTGGTTTCCTGAGCCACCTTTACTCTGCTCTATGCCAGGCTGTGCTAGCAACACCCAAAGGTGGCCTGCGGGGAGCCATCACCTAGGACTGACTCGGCAGTGTGCAGTGGTGCATGCACTGTCTCAGCCAACCCGCTCCACTACCCGGCAGGGTACACATTCGCACCCCTACTTCACAGAGGAAGAAACCTGGAACCAGAGGGGGCGTGCCTGCCAAGCTCACACAGCAGGAACTGA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaohui Xu et al.
Experimental and therapeutic medicine, 13(5), 1993-1999 (2017-06-02)
Proprotein convertase subtilisin/kexin type 9 (PCSK9) is a member of the subtilisin family of PCs that encodes a neural apoptosis-regulated convertase 1. However, the precise role of PCSK9 in lung cancer cell apoptosis has remained elusive. In the present study
Yanting Zou et al.
Inflammation, 43(1), 251-263 (2019-11-30)
Lipopolysaccharide (LPS) is demonstrated to cause "two-hit" injury to liver. Proprotein convertase subtilisin/kexin type 9 (PCSK9) plays an important role in LPS clearance. Hepatocyte nuclear factor-1 alpha (HNF-1α) and sterol regulatory element-binding protein 2 (SREBP2) were reported to be responsible
Ga Eun Lee et al.
Frontiers in endocrinology, 11, 607144-607144 (2021-01-26)
The proprotein convertase subtilisin/kexin type 9 (PCSK9) has been implicated in the pathogenesis of inflammatory diseases. We sought to investigate the role of PCSK9 in the pathogenesis of Graves' orbitopathy (GO) and whether it may be a legitimate target for
Dan Heo et al.
Nanotechnology, 26(33), 335101-335101 (2015-08-01)
The specific delivery of ribonucleic acid (RNA) interfering molecules to disease-related cells is still a critical blockade for in vivo systemic treatment. Here, this study suggests a robust delivery carrier for targeted delivery of RNA-interfering molecules using galactosylated magnetic nanovectors
Shirya Rashid et al.
Circulation, 130(5), 431-441 (2014-07-30)
Proprotein convertase subtilisin kexin type 9 (PCSK9) promotes the degradation of the low-density lipoprotein (LDL) receptor (LDLR), and its deficiency in humans results in low plasma LDL cholesterol and protection against coronary heart disease. Recent evidence indicates that PCSK9 also

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico