Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU059561

Sigma-Aldrich

MISSION® esiRNA

targeting human CRHR1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGCCATCGTGCTCACCTACTCCACTGACCGGCTGCGCAAATGGATGTTCATCTGCATTGGCTGGGGTGTGCCCTTCCCCATCATTGTGGCCTGGGCCATTGGGAAGCTGTACTACGACAATGAGAAGTGCTGGTTTGGCAAAAGGCCTGGGGTGTACACCGACTACATCTACCAGGGCCCCATGATCCTGGTCCTGCTGATCAATTTCATCTTCCTTTTCAACATCGTCCGCATCCTCATGACCAAGCTCCGGGCATCCACCACGTCTGAGACCATTCAGTACAGGAAGGCTGTGAAAGCCACTCTGGTGCTGCTGCCCCTCCTGGGCATCACCTACATGCTGTTCTTCGTCAATCCCGGGGAGGATGAGGTCTCCCGGGTCGTCTTCATCTACTTCAACTCCTTCCTGGAATCCTTCC

Ensembl | nº de acceso humano

ENSG00000120088

Nº de acceso NCBI

NM_004382

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CRHR1(104909134) , CRHR1(1394)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yanmin Zhang et al.
Endocrinology, 159(2), 622-638 (2017-11-11)
Corticotropin-releasing hormone (CRH) is believed to play a critical role in stress-induced synaptic formation and modification. In the current study, we explored the mechanisms underlying CRH modulation of synaptic formation in the hippocampus by using various models in vitro. In
Saravanan Ayyadurai et al.
Journal of leukocyte biology, 102(6), 1299-1312 (2017-07-08)
Life stress is a major risk factor in the onset and exacerbation of mast cell-associated diseases, including allergy/anaphylaxis, asthma, and irritable bowel syndrome. Although it is known that mast cells are highly activated upon stressful events, the mechanisms by which

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico