Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU059391

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK5RAP2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GATGGCTCTGGTCCTGGATGAGAAAGACAGACTGATTGAGGAGTTGAAGCTGTCTTTGAAGAGCAAAGAAGCTTTAATTCAGTGCCTTAAAGAGGAGAAATCTCAGATGGCATGTCCTGATGAGAATGTGTCATCTGGAGAGCTCCGAGGACTTTGTGCTGCTCCAAGGGAAGAAAAGGAGAGAGAAACTGAGGCTGCACAAATGGAGCATCAGAAGGAGAGAAACAGCTTTGAAGAGAGGATCCAGGCACTTGAAGAGGACCTGAGAGAGAAGGAAAGAGAAATTGCTACAGAGAAGAAAAATAGTCTAAAGAGGGATAAAGCCATTCAGGGTTTAACCATGGCATTAAAATCAAAGGAAAAAAAGGTTGAAGAACTTAACTCTGAAATTGAAAAGCTCAGTGCTGCCTTTGCTAAAGC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shoji Hata et al.
Nature cell biology, 21(9), 1138-1151 (2019-09-05)
One of the first steps in mitotic spindle assembly is the dissolution of the centrosome linker followed by centrosome separation driven by EG5, a tetrameric plus-end-directed member of the kinesin-5 family. However, even in the absence of the centrosome linker

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico