Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU059281

Sigma-Aldrich

MISSION® esiRNA

targeting human TCF12

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCATCCTGGGCTTAGTGAAACTACCAACCCTATGGGTCATATGTAAACATCAGCCAGTTCCAGAGTTATCAGTAGGCTAGATAGAAGGTGACCTCTCCTCATAAGGACTTGGACAACTCAGATTATCTGAAGACACAAACCTGACAGGAGGGAGAAGAAAAAACAAAACACTTGAACCAAGAAACTCAAATGTAATCCTACGATCAAAGCAACTGGTCAACACTTCCATCAGAAGTGAAGATAGGAAGCTCATCAGATAGAACATCAGCCCATGAGATGTTTGCAACAAATCTTTTGTTGCAAGCAGTGTGTCGCTTCTGCACAATCAGAGACTGTCTCGATCTCTCCACTCACCGTGGAAGTTGCCTTGTGCCTAAACTGAATTGACAAATGCATTGTAACTACAAATTTTATTTATTGTTATGAAACTGTAAGGTCTACATATAAAGGGAAAAAGTTAATGTGGAAAGCTGATCTACACTCAGCTGATGCCA

Ensembl | nº de acceso humano

ENSG00000140262

Nº de acceso NCBI

NM_003205

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TCF12(6938) , TCF12(6938)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Paulo R D V Godoy et al.
Molecular medicine reports, 14(6), 5253-5260 (2016-10-26)
Glioblastoma multiforme (GBM) is a lethal tumor and novel strategies are required to overcome resistance. Transcription factor 12 (HEB) has been associated with neural and stem cell proliferation, is overexpressed in certain tumor types and is induced in irradiated U87MG cells.
Leila Pirhaji et al.
Nature communications, 8(1), 623-623 (2017-09-22)
The immense and growing repositories of transcriptional data may contain critical insights for developing new therapies. Current approaches to mining these data largely rely on binary classifications of disease vs. control, and are not able to incorporate measures of disease
Duo Wen et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(8), 6211-6221 (2015-03-11)
Malic enzyme 1 (ME1) links the glycolytic and citric acid cycles and is important for NADPH production, glutamine metabolism, and lipogenesis. Recently, its deregulation has been implicated in the progression of various cancers. However, the role of ME1 in the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico