Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU059231

Sigma-Aldrich

MISSION® esiRNA

targeting human PARK2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AATTCCAAACCGGATGAGTGGTGAATGCCAATCCCCACACTGCCCTGGGACTAGTGCAGAATTTTTCTTTAAATGTGGAGCACACCCCACCTCTGACAAGGAAACATCAGTAGCTTTGCACCTGATCGCAACAAATAGTCGGAACATCACTTGCATTACGTGCACAGACGTCAGGAGCCCCGTCCTGGTTTTCCAGTGCAACTCCCGCCACGTGATTTGCTTAGACTGTTTCCACTTATACTGTGTGACAAGACTCAATGATCGGCAGTTTGTTCACGACCCTCAACTTGGCTACTCCCTGCCTTGTGTGGCTGGCTGTCCCAACTCCTTGATTAAAGAGCTCCATCACTTCAGGATTCTGGGAGAAGAGCAGTACAACCGGTACCAGCAGTATGGTGCAGAGGAGTGTGTCCTGCAGATGGGGGGCGTGTTATGCCCCCGCCCTGGCTGTGGAGCGGGGCTGCTGCCGGAGCCTGACCAGAGGAAAGTCACCTGCGAA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Saburo Ito et al.
Autophagy, 11(3), 547-559 (2015-02-26)
Cigarette smoke (CS)-induced mitochondrial damage with increased reactive oxygen species (ROS) production has been implicated in COPD pathogenesis by accelerating senescence. Mitophagy may play a pivotal role for removal of CS-induced damaged mitochondria, and the PINK1 (PTEN-induced putative kinase 1)-PARK2
Zhengjun Gao et al.
Nature communications, 8(1), 1805-1805 (2017-11-29)
Macrophages, dendritic cells and other innate immune cells are involved in inflammation and host defense against infection. Metabolic shifts in mitochondrial dynamics may be involved in Toll-like receptor agonist-mediated inflammatory responses and immune cell polarization. However, whether the mitochondrial morphology
Vinay Choubey et al.
Autophagy, 10(6), 1105-1119 (2014-06-01)
The autophagy protein BECN1/Beclin 1 is known to play a central role in autophagosome formation and maturation. The results presented here demonstrate that BECN1 interacts with the Parkinson disease-related protein PARK2. This interaction does not require PARK2 translocation to mitochondria
Pedro Elói Antunes Dionísio et al.
Molecular neurobiology, 56(4), 2990-3004 (2018-08-04)
Parkin is an E3 ubiquitin ligase involved in Parkinson's disease (PD). Necroptosis is a regulated form of cell death that depends on receptor interacting protein 1 (RIP1) and 3 (RIP3). Importantly, parkin has been implicated in ubiquitination events that can

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico