Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU059191

Sigma-Aldrich

MISSION® esiRNA

targeting human CAMK2B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGTCAGCCAGAGATCACCAGAAGCTGGAGAGAGAGGCTCGGATCTGCCGCCTTCTGAAGCATTCCAACATCGTGCGTCTCCACGACAGCATCTCCGAGGAGGGCTTCCACTACCTGGTCTTCGATCTGGTCACTGGTGGGGAGCTCTTTGAAGACATTGTGGCGAGAGAGTACTACAGCGAGGCTGATGCCAGTCACTGTATCCAGCAGATCCTGGAGGCCGTTCTCCATTGTCACCAAATGGGGGTCGTCCACAGAGACCTCAAGCCGGAGAACCTGCTTCTGGCCAGCAAGTGCAAAGGGGCTGCAGTGAAGCTGGCAGACTTCGGCCTAGCTATCGAGGTGCAGGGGGACCAGCAGGCATGGTTTGGTTTCGCTGGCACACCAGGCTACCTGTCCCCTGAGGTCCTTCGCAAAGAG

Ensembl | nº de acceso humano

ENSG00000058404

Nº de acceso NCBI

NM_172084

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CAMK2B(816) , CAMK2B(816)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jianwei Li et al.
Nature communications, 10(1), 1589-1589 (2019-04-10)
Transmembrane and coiled-coil domains 1 (TMCO1) is a recently identified Ca2+ leak channel in the endoplasmic reticulum. TMCO1 dysfunction in humans is associated with dysmorphism, mental retardation, glaucoma and the occurrence of cancer. Here we show an essential role of
Sébastien Küry et al.
American journal of human genetics, 101(5), 768-788 (2017-11-04)
Calcium/calmodulin-dependent protein kinase II (CAMK2) is one of the first proteins shown to be essential for normal learning and synaptic plasticity in mice, but its requirement for human brain development has not yet been established. Through a multi-center collaborative study

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico