Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU059031

Sigma-Aldrich

MISSION® esiRNA

targeting human MED15

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATTCTGACAGACCCCTCGAAGCGGTGTCCCCTGAAGACCTTGCAAAAGTGTGAGATCGCCCTGGAGAAACTCAAGAATGACATGGCGGTGCCCACTCCCCCACCGCCCCCGGTGCCACCGACCAAACAGCAGTACCTATGCCAGCCGCTCCTGGATGCCGTCCTGGCCAACATCCGCTCACCTGTCTTCAACCATTCCCTGTACCGCACATTCGTTCCAGCCATGACCGCCATTCACGGCCCACCCATCACGGCCCCAGTGGTGTGCACCCGGAAGCGCAGGCTTGAGGATGATGAGCGGCAGAGCATCCCCAGTGTGCTCCAGGGTGAGGTGGCCAGGCTGGACCCCAAGTTCCTGGTAAACCTGGACCCTTCTCACTGCAGCAACAATGGCACTGTCCACCTGATCTGCAAGCTGGAT

Ensembl | nº de acceso humano

ENSG00000099917

Nº de acceso NCBI

NM_015889

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MED15(51586) , MED15(51586)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Isabella Syring et al.
Oncology letters, 16(3), 3013-3021 (2018-08-22)
The Mediator complex, a multi-subunit protein complex, plays an integral role in regulating transcription. Genetic alterations of the mediator subunit 15 (MED15) in separate tumor entities have been described previously. However, till now, not much is known about the role
Anne Offermann et al.
Oncotarget, 8(5), 7964-7976 (2016-12-16)
Androgen deprivation therapy (ADT) is the main therapeutic option for advanced prostate cancer (PCa). After initial regression, most tumors develop into castration-resistant PCa (CRPC). Previously, we found the Mediator complex subunit MED15 to be overexpressed in CRPC and to correlate

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico