Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU056221

Sigma-Aldrich

MISSION® esiRNA

targeting human COPB1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCCTGTTCTGTCCGATTTCCAGATATGGCTGCAAATGTTATTCCTGTGTTAATGGAATTTCTCAGTGACAACAACGAAGCAGCAGCTGCTGATGTCTTGGAGTTTGTTCGTGAAGCCATTCAGCGCTTTGATAACCTGAGAATGCTTATTGTTGAGAAGATGCTTGAAGTCTTTCATGCTATTAAATCTGTCAAGATTTACCGAGGAGCATTATGGATCCTGGGAGAATACTGTAGTACCAAGGAAGACATTCAGAGTGTGATGACTGAGATCCGCAGGTCCCTTGGAGAGATCCCAATTGTAGAGTCAGAAATAAAGAAAGAAGCTGGTGAATTAAAACCTGAAGAAGAAATAACTGTAGGGCCAGTTCAGAAATTGGTTACTGAAATGGGTACCTATGCAACTCAGAGTGCCCTTAGCAGTTCTAGACCCACCAAGAAAGAGGAA

Ensembl | nº de acceso humano

ENSG00000129083

Nº de acceso NCBI

NM_016451

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... COPB1(1315) , COPB1(1315)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
TQU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Nisha Bte Mohd Rafiq et al.
The Journal of cell biology, 216(1), 181-197 (2016-12-23)
Podosomes represent a class of integrin-mediated cell-matrix adhesions formed by migrating and matrix-degrading cells. We demonstrate that in macrophage-like THP1 cells and fibroblasts stimulated to produce podosomes, down-regulation of the G-protein ARF1 or the ARF1 guanine nucleotide exchange factor, ARNO
Hiroki Kobayashi et al.
Biochemical and biophysical research communications, 467(1), 121-127 (2015-09-26)
Combining glycolytic inhibition with other anti-cancer therapies is a potential approach to treating cancer. In this context, we attempted to identify genes that determine sensitivity to 2-deoxyglucose (2DG), a glycolytic inhibitor, in cancer cells using pooled shRNA libraries targeting ∼15,000

Protocolos

Coronavirus qPCR Design Case Study & Related Products to Support SARS-CoV-2 Research

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico