Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU056151

Sigma-Aldrich

MISSION® esiRNA

targeting human SPOP

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTTGCGAGTAAACCCCAAAGGGTTAGATGAAGAAAGCAAAGATTACCTGTCACTTTACCTGTTACTGGTCAGCTGTCCAAAGAGTGAAGTTCGGGCAAAATTCAAATTCTCCATCCTGAATGCCAAGGGAGAAGAAACCAAAGCTATGGAGAGTCAACGGGCATATAGGTTTGTGCAAGGCAAAGACTGGGGATTCAAGAAATTCATCCGTAGAGATTTTCTTTTGGATGAGGCCAACGGGCTTCTCCCTGATGACAAGCTTACCCTCTTCTGCGAGGTGAGTGTTGTGCAAGATTCTGTCAACATTTCTGGCCAGAATACCATGAACATGGTAAAGGTTCCTGAGTGCCGGCTGGCAGATGAGTTAGGAGGACTGTGGGAGAATTCCCGGTTCACAGACTGCTGCTTGTGTGTTGCCGGCCAGGAATTCCAGGCTCACAAGGCTAT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Rihan El Bezawy et al.
Cancers, 12(6) (2020-06-10)
Speckle-type POZ (pox virus and zinc finger protein) protein (SPOP) is the most commonly mutated gene in prostate cancer (PCa). Recent evidence reports a role of SPOP in DNA damage response (DDR), indicating a possible impact of SPOP deregulation on
Dan Zhang et al.
Carcinogenesis, 35(8), 1691-1697 (2014-01-24)
Speckle-type POZ protein (SPOP) is an adaptor of the cullin 3-based ubiquitin ligase responsible for the degradation of oncoproteins frequently overexpressed in many tumor cells. Altered expression and somatic mutations of SPOP have been observed in various tumor types with

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico