Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU055911

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC5A8

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCAAGAAAGTGTCTGCACCAGACCAGCTCATGCCTTATTTGGTACTGGACATTCTGCAAGATTATCCAGGACTTCCTGGACTTTTTGTGGCCTGTGCTTACAGTGGGACATTAAGCACAGTGTCCTCCAGTATTAATGCCTTAGCAGCAGTAACTGTGGAAGATCTAATCAAACCTTACTTCAGATCGCTCTCAGAAAGGTCTCTGTCTTGGATTTCCCAAGGAATGAGTGTGGTGTATGGAGCCCTGTGTATTGGAATGGCTGCGCTGGCGTCACTTATGGGAGCTTTGTTGCAGGCAGCACTCAGCGTATTTGGTATGGTTGGTGGACCACTTATGGGCCTGTTCGCTTTGGGCATTTTGGTTCCCTTTGCCAACTCAATTGGAGCACTTGTTGGTCTGATGGCTGGATTTGCCATTTCTCTATGGGTTGGAATTGGAGCTCAAA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Adriana López-Barradas et al.
American journal of physiology. Cell physiology, 311(5), C720-C734 (2016-11-03)
SMCTs move several important fuel molecules that are involved in lipid, carbohydrate, and amino acid metabolism, but their regulation has been poorly studied. Insulin controls the translocation of several solutes that are involved in energetic cellular metabolism, including glucose. We
Taoufik Nedjadi et al.
Experimental physiology, 99(10), 1335-1347 (2014-08-31)
The diet of the horse, pasture forage (grass), is fermented by the equine colonic microbiota to short-chain fatty acids, notably acetate, propionate and butyrate. Short-chain fatty acids provide a major source of energy for the horse and contribute to many

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico