Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU054741

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKD1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGCTTCTGAAGGGGCTTTTCAGGCAGGGCTTGCAGTGCAAAGATTGCAGATTCAACTGCCATAAACGTTGTGCACCGAAAGTACCAAACAACTGCCTTGGCGAAGTGACCATTAATGGAGATTTGCTTAGCCCTGGGGCAGAGTCTGATGTGGTCATGGAAGAAGGGAGTGATGACAATGATAGTGAAAGGAACAGTGGGCTCATGGATGATATGGAAGAAGCAATGGTCCAAGATGCAGAGATGGCAATGGCAGAGTGCCAGAACGACAGTGGCGAGATGCAAGATCCAGACCCAGACCACGAGGACGCCAACAGAACCATCAGTCCATCAACAAGCAACAATATCCCACTCATGAGGGTAGTGCAGTCTGTCAAACACACGAAGAGGAAAAGCAGCAC

Ensembl | nº de acceso humano

ENSG00000184304

Nº de acceso NCBI

NM_002742

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PRKD1(5587) , PRKD1(5587)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kimberly A Coughlan et al.
The Journal of biological chemistry, 291(11), 5664-5675 (2016-01-23)
AMP-activated protein kinase (AMPK) is an energy-sensing enzyme whose activity is inhibited in settings of insulin resistance. Exposure to a high glucose concentration has recently been shown to increase phosphorylation of AMPK at Ser(485/491) of its α1/α2 subunit; however, the
Qi Zhou et al.
Archives of toxicology, 93(6), 1639-1648 (2019-04-26)
2,3',4,4',5-Pentachlorobiphenyl (PCB118) has been shown to cause thyroidal ultrastructure lesions, but the underlying mechanism remains elusive. This study aimed to elucidate the mechanism by which PCB118 induces the abnormalities of the thyrocytes. Wistar rats were injected intraperitoneally with PCB118 (0
Jonathan Baker et al.
PloS one, 13(4), e0195864-e0195864 (2018-04-14)
Many catabolic stimuli, including interleukin-1 (IL-1) in combination with oncostatin M (OSM), promote cartilage breakdown via the induction of collagen-degrading collagenases such as matrix metalloproteinase 1 (MMP1) and MMP13 in human articular chondrocytes. Indeed, joint diseases with an inflammatory component
Di Zhao et al.
International journal of biological sciences, 13(3), 276-285 (2017-04-04)
Growing evidence shows that protein kinase D (PKD) plays an important role in the development of pressure overload-induced cardiac hypertrophy. However, the mechanisms involved are not clear. This study tested our hypothesis that PKD might mediate cardiac hypertrophy by negatively
Jia Wang et al.
American journal of physiology. Cell physiology, 310(7), C542-C557 (2016-01-08)
Given the fundamental role of β-catenin signaling in intestinal epithelial cell proliferation and the growth-promoting function of protein kinase D1 (PKD1) in these cells, we hypothesized that PKDs mediate cross talk with β-catenin signaling. The results presented here provide several
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico