Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU054411

Sigma-Aldrich

MISSION® esiRNA

targeting human USF1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCTGGCACTGGTCAATTCTTTGTGATGATGTCACCACAAGAAGTACTGCAGGGAGGAAGCCAGCGCTCAATTGCCCCTAGGACTCACCCTTATTCCCCGAAGTCAGAAGCTCCCCGGACGACTCGGGATGAGAAACGCAGGGCTCAGCATAATGAAGTGGAGCGTCGCCGCCGAGACAAGATCAACAACTGGATCGTGCAGCTCTCCAAGATAATCCCAGACTGCTCTATGGAGAGCACCAAGTCTGGCCAGAGTAAAGGTGGGATTCTATCCAAAGCTTGTGATTATATCCAGGAGCTTCGGCAGAGTAACCACCGCTTGTCTGAAGAACTGCAGGGACTTGACCAACTGCAGCTGGACAATGACGTGCTTCGACAACAGGTGGAAGATCTTAAAAACAAGAATCTGCTGCTTCGAGCTCAGTTGCGGCACCACGGATTAGAGGTCGT

Ensembl | nº de acceso humano

ENSG00000158773

Nº de acceso NCBI

NM_007122

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... USF1(7391) , USF1(7391)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiangxiang Liu et al.
Molecular therapy. Nucleic acids, 22, 750-765 (2020-11-25)
Hepatocellular carcinoma (HCC), one of the most aggressive malignancies, ranks as the fourth leading cause of cancer-related deaths worldwide. Emerging evidence indicates that RNA N6-methyladenosine (m6A) plays a critical role in tumor progression. However, the biological function of YTHDF1 in
Xiu-Juan Ding et al.
Theranostics, 10(24), 11110-11126 (2020-10-13)
Rationale: Many external factors can induce the melanogenesis and inflammation of the skin. Salidroside (SAL) is the main active ingredient of Rhodiola, which is a perennial grass plant of the Family Crassulaceae. This study evaluated the effect and molecular mechanism
Jun Guo et al.
FEBS letters, 592(16), 2725-2738 (2018-07-29)
Previous studies indicate that the transcription factor upstream stimulating factor 1 (USF1) is involved in the regulation of lipid and glucose metabolism. However, the role of USF1 in lipid-induced autophagy remains unknown. Interestingly, we found that USF1 overexpression suppresses autophagy-related
Chunyu Cao et al.
International journal of cancer, 143(6), 1388-1401 (2018-04-11)
Our recent studies have shown that cross-talk between histone deacetylase 5 (HDAC5) and lysine-specific demethylase 1 (LSD1) facilitates breast cancer progression. In this work, we demonstrated that regulatory activity at -356 to -100 bp promoter element plays a critical role
Griselda Vallejo et al.
PloS one, 9(5), e97311-e97311 (2014-05-27)
Although non-genomic steroid receptor pathways have been studied over the past decade, little is known about the direct gene expression changes that take place as a consequence of their activation. Progesterone controls proliferation of rat endometrial stromal cells during the
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico