Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU053981

Sigma-Aldrich

MISSION® esiRNA

targeting human PPL

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACAGACAGCCTCAGCCAGATGGAGACCAAGCTGAAGAACCAGAAGAACCTGCTAGATGAGATAGCAAGTAGGGAGCAGGAAGTACAGAAGATCTGTGCCAATTCCCAGCAGTACCAGCAAGCTGTAAAGGACTATGAGTTAGAAGCAGAAAAACTAAGGTCTCTTCTCGACTTGGAGAATGGAAGGAGAAGCCACGTGAGCAAGAGAGCCAGGCTCCAATCTCCTGCCACCAAAGTGAAGGAAGAGGAAGCAGCACTTGCCGCCAAGTTCACTGAAGTTTATGCCATCAACAGACAGAGGCTGCAGAATCTGGAGTTTGCTCTGAATCTCCTCAGACAGCAGCCGGAAGTAGAAGTGACCCATGAGACCCTGCAAAGGAATAGGCCGGACTCTGGAGTGGAGGAGGCGTGGAAGATCAGGAAGGAACTGGATGAGGAGACTGAGCGGAG

Ensembl | nº de acceso humano

ENSG00000118898

Nº de acceso NCBI

NM_002705

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PPL(5493) , PPL(5493)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hui Mei Lee et al.
Scientific reports, 9(1), 2357-2357 (2019-02-23)
The use of EGFR inhibitors on oral squamous cell carcinoma (OSCC) as monotherapy yielded modest clinical outcomes and therefore would benefit from biomarkers that could predict which patient subsets are likely to respond. Here, we determined the efficacy of erlotinib
Yurie Tonoike et al.
BMC cell biology, 12, 41-41 (2011-09-29)
We previously reported that periplakin (PPL) is downregulated in human esophageal cancer tissues compared to the adjacent non-cancer epithelium. Thus PPL could be a useful marker for detection of early esophageal cancer and evaluation of tumor progression, but largely remains

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico