Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU052581

Sigma-Aldrich

MISSION® esiRNA

targeting human KDM1B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGTGATGGAACTGGATGAGCTCTATGAGTTTCCAGAGTATTCCCGAGACCCCACCATGTACCTGGCTTTGAGAAACCTCATCCTCGCACTGTGGTATACTAACTGCAAAGAAGCTCTTACTCCTCAGAAATGTATTCCTCACATCATCGTCCGGGGTCTCGTGCGTATTCGATGCGTTCAGGAAGTGGAGAGAATACTGTATTTTATGACCAGAAAAGGTCTCATCAACACTGGAGTTCTCAGCGTGGGAGCCGACCAGTATCTTCTCCCTAAGGACTACCACAATAAATCAGTCATCATTATCGGGGCTGGTCCAGCAGGATTAGCAGCTGCTAGGCAACTGCATAACTTTGGAATTAAGGTGACTGTCCTGGAAGCCAAAGACAGAATTGGAGGCCGAGTCTGGGATGATAAATCTTTTAAAGGCGTCACAGTGGGAAGAGGAGCTCA

Ensembl | nº de acceso humano

ENSG00000165097

Nº de acceso NCBI

NM_153042

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... KDM1B(221656) , AOF1(221656)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Aman Kumar et al.
Molecular biology reports, 47(9), 7273-7276 (2020-08-06)
NLRP3 pathway plays a vital role in the pathogenesis of different human cancers but still the regulation of NLRP3 pathway largely unknown. Therefore, we examined the levels of NLRP3 and its downstream components (caspase-1 and IL-1β) and its relationship with
Aman Kumar et al.
Scientific reports, 9(1), 8189-8189 (2019-06-05)
Renal cell carcinoma (RCC) is the leading cause among cancer-related deaths due to urological cancers, which results in response to combination of genetic and epigenetic factors. Histone methylations have been implicated in renal tumorigenesis but their clinical significance and underlying

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico