Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU051701

Sigma-Aldrich

MISSION® esiRNA

targeting human BDKRB1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTCTTGAGCATCCCCACATTCCTGCTGCGATCCATCCAAGCCGTCCCAGATCTGAACATCACCGCCTGCATCCTGCTCCTCCCCCATGAGGCCTGGCACTTTGCAAGGATTGTGGAGTTAAATATTCTGGGTTTCCTCCTACCACTGGCTGCGATCGTCTTCTTCAACTACCACATCCTGGCCTCCCTGCGAACGCGGGAGGAGGTCAGCAGGACAAGGTGCGGGGGCCGCAAGGATAGCAAGACCACAGCGCTGATCCTCACGCTCGTGGTTGCCTTCCTGGTCTGCTGGGCCCCTTACCACTTCTTTGCCTTCCTGGAATTCTTATTCCAGGTGCAAGCAGTCCGAGGCTGCTTTTGGGAGGACTTCATTGACCTGGGCCTGCAATTGGCCAACTTCTTTGCCTTCACTAACAGCTCCCTGAATCCAGTAATTTATGTCTTTGTGGGCCG

Ensembl | nº de acceso humano

ENSG00000100739

Nº de acceso NCBI

NM_000710

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... BDKRB1(623) , BDKRB1(623)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Guojun Wang et al.
Journal of cellular biochemistry, 118(12), 4444-4453 (2017-05-04)
Bradykinin (BK) has been reported to be involved in the progression of diverse types of cancer. In the present study, we investigated the possible role of BK in cell proliferation, migration, invasion, and tumor growth of gastric cancer (GC). Cell
Ding-Ping Sun et al.
Cancers, 12(3) (2020-03-19)
Glioblastoma multiforme (GBM) is the most common form of brain tumor and is very aggressive. Rapid migration and invasion of glioblastoma cells are two typical features driving malignance of GBM. Bradykinin functionally prompts calcium influx via activation of bradykinin receptor

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico