Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU050931

Sigma-Aldrich

MISSION® esiRNA

targeting human CD14

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCGCTGTGTAGGAAAGAAGCTAAAGCACTTCCAGAGCCTGTCCGGAGCTCAGAGGTTCGGAAGACTTATCGACCATGGAGCGCGCGTCCTGCTTGTTGCTGCTGCTGCTGCCGCTGGTGCACGTCTCTGCGACCACGCCAGAACCTTGTGAGCTGGACGATGAAGATTTCCGCTGCGTCTGCAACTTCTCCGAACCTCAGCCCGACTGGTCCGAAGCCTTCCAGTGTGTGTCTGCAGTAGAGGTGGAGATCCATGCCGGCGGTCTCAACCTAGAGCCGTTTCTAAAGCGCGTCGATGCGGACGCCGACCCGCGGCAGTATGCTGACACGGTCAAGGCTCTCCGCGTGCGGCGGCTCACAGTGGGAGCCGCACAGGTTCCTGCTCAGCTACTGGTAGGCGCCCTGCGTGTGCTAGCGTACTCCCGCCTCAAGGAACTGACGCTCGAGGACCTA

Ensembl | nº de acceso humano

ENSG00000170458

Nº de acceso NCBI

NM_000591

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CD14(929) , CD14(929)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mai Fujikura et al.
Journal of Alzheimer's disease : JAD, 68(1), 323-337 (2019-02-19)
We previously demonstrated that microglia play an essential role in clearance of amyloid-β (Aβ) in Alzheimer's disease (AD)-like pathology. Our prior work also showed that several receptors expressed on microglia participated in Aβ phagocytosis. However, clathrin-mediated endocytosis (CME), which is
Nathalie Bonello-Palot et al.
Atherosclerosis, 237(1), 45-52 (2014-09-10)
Defects in lamin A maturation result in premature aging syndromes and severe atherosclerosis as observed in the Hutchinson-Gilford Progeria Syndrome. In age-related atherosclerosis, several features of cellular senescence have been characterized in endothelial cells including telomere shortening and increased oxidative
Elena M V de Cavanagh et al.
American journal of physiology. Heart and circulatory physiology, 307(2), H207-H215 (2014-05-27)
Early endothelial progenitor cells (early EPC) and late EPC are involved in endothelial repair and can rescue damaged endothelial cells by transferring organelles through tunneling nanotubes (TNT). In rodents, EPC mobilization from the bone marrow depends on sympathetic nervous system

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico