Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU050261

Sigma-Aldrich

MISSION® esiRNA

targeting human FRZB

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAACTGTAGAGGGGCAAGCAGTGAACGCTGTAAATGTAAGCCTATTAGAGCTACACAGAAGACCTATTTCCGGAACAATTACAACTATGTCATTCGGGCTAAAGTTAAAGAGATAAAGACTAAGTGCCATGATGTGACTGCAGTAGTGGAGGTGAAGGAGATTCTAAAGTCCTCTCTGGTAAACATTCCACGGGACACTGTCAACCTCTATACCAGCTCTGGCTGCCTCTGCCCTCCACTTAATGTTAATGAGGAATATATCATCATGGGCTATGAAGATGAGGAACGTTCCAGATTACTCTTGGTGGAAGGCTCTATAGCTGAGAAGTGGAAGGATCGACTCGGTAAAAAAGTTAAGCGCTGGGATATGAAGCTTCGTCATCTTGGACTCAGTAAAAGTGATTCTAGCAATAGTGATTCCACTCAGAGTCAGAAGTCTGGCAGGAACTCGAA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

De-Zhi Zheng et al.
Current neurovascular research, 14(1), 32-38 (2017-04-07)
Periprosthetic osteolysis induced by wear particles can lead to aseptic loosening, one main reason of arthroplasty failure. However, the role of microRNA-130b (miR-130b) in particle-induced osteolysis (PIO) has not been explored yet. In this study, PIO models were established in
Liang-Jie Wang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(1), 314-326 (2018-07-07)
Migration of placental extravillous trophoblast (EVT) cells into uterine decidua facilitates the establishment of blood circulation between mother and fetus and is modulated by EVT-decidual cell interaction. Poor or excessive EVT migration is associated with pregnancy complications such as preeclampsia
Julie J G Kephart et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 21(21), 4868-4880 (2015-06-14)
Rhabdomyosarcoma (RMS) is a soft tissue sarcoma associated with the skeletal muscle lineage. Of the two predominant subtypes, known as embryonal (eRMS) and alveolar (aRMS), aRMS has the poorer prognosis, with a five-year survival rate of <50%. The majority of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico