Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU050181

Sigma-Aldrich

MISSION® esiRNA

targeting human LRG1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCATCTCCTGTCAACCACCTGCCGAAATCCCCGGCTACCTGCCAGCCGACACCGTGCACCTGGCCGTGGAATTCTTCAACCTGACCCACCTGCCAGCCAACCTCCTCCAGGGCGCCTCTAAGCTCCAAGAATTGCACCTCTCCAGCAATGGGCTGGAAAGCCTCTCGCCCGAATTCCTGCGGCCAGTGCCGCAGCTGAGGGTGCTGGATCTAACCCGAAACGCCCTGACCGGGCTGCCCCCGGGCCTCTTCCAGGCCTCAGCCACCCTGGACACCCTGGTATTGAAAGAAAACCAGCTGGAGGTCCTGGAGGTCTCGTGGCTACACGGCCTGAAAGCTCTGGGGCATCTGGACCTGTCTGGGAACCGCCTCCGGAAACTGCCCCCCGGGCTGCTGGCCAACTTCACCCTCCTGCGCACCCTTGACCTTGGGGAGAACCAGTTGGAGACCTTGC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yiyun Wang et al.
Cell death & disease, 8(3), e2715-e2715 (2017-03-31)
The incomplete understanding of aberrant neovascularization, which contributes to osteoarthritis suggests that additional modulators have yet to be identified. Our objective was to identify the role of Leucine-rich-alpha-2-glycoprotein1 (LRG1), a new regulator of pathogenic angiogenesis, in osteoarthritis progression and to
Lan Luan et al.
Experimental and therapeutic medicine, 21(4), 367-367 (2021-03-19)
Retinoblastoma (RB) is the most common primary intraocular cancer type that occurs during retinal development in childhood. Previous studies have reported that long non-coding RNAs (lncRNAs) are involved in the development of RB. Therefore, the aim of the present study
Qian Zhang et al.
OncoTargets and therapy, 11, 2745-2752 (2018-05-23)
Leucine-rich α-2-glycoprotein-1 (LRG1) is differentially expressed in many kinds of diseases including cancer, however, it has not been thoroughly studied yet. The objective of this study was to detect the expression and potential mechanism of LRG1 in colorectal cancer (CRC).
Masaaki Yamamoto et al.
Cancer science, 108(10), 2052-2060 (2017-07-27)
Gastric cancer is one of the most common malignant tumors. Although improvement in chemotherapy has been achieved, the clinical prognosis of advanced gastric cancer remains poor. Therefore, it is increasingly important to predict the prognosis and determine whether patients should
Gu Gong et al.
Journal of molecular neuroscience : MN, 54(1), 20-26 (2014-02-15)
Lipopolysaccharide (LPS) preconditioning is a powerful neuroprotective phenomenon by which an injurious stimulus renders the brain resistant to a subsequent damaging ischemic insult. The LPS response gene (Lrg) is a recently identified gene in human dental pulp cells treated with

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico