Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU048861

Sigma-Aldrich

MISSION® esiRNA

targeting human PALB2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGCTGCCAAGCAGAAGAAAGAAGCAGCAGAAGAGGACATTTATTTCACAGGAGAGAGACTGTGTCTTTGGCACTGATTCACTCAGATTGTCTGGGAAAAGACTAAAGGAACAGGAAGAAATCAGTAGCAAAAATCCTGCTAGATCACCAGTAACTGAAATAAGAACTCACCTTTTAAGTCTTAAATCTGAACTTCCAGATTCTCCAGAACCAGTTACAGAAATTAATGAAGACAGTGTATTAATTCCACCAACTGCCCAACCAGAAAAAGGTGTTGATACATTCCTAAGAAGACCTAATTTCACCAGGGCGACTACAGTTCCTTTACAGACTCTATCAGATAGCGGTAGTAGTCAGCACCTTGAACACATTCCTCCTAAAGGTAGCAGTGAACTTACTACTCACGACCTAAAAAACATTAGATTTACTTCACCTGTAAGTTTGGAGGCACAAGGC

Ensembl | nº de acceso humano

ENSG00000083093

Nº de acceso NCBI

NM_024675

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PALB2(79728) , PALB2(79728)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Joris Pauty et al.
Nucleic acids research, 45(5), 2644-2657 (2017-02-06)
One typical mechanism to promote genomic instability, a hallmark of cancer, is to inactivate tumor suppressors, such as PALB2. It has recently been reported that mutations in PALB2 increase the risk of breast cancer by 8-9-fold by age 40 and
Antonis C Antoniou et al.
The New England journal of medicine, 371(6), 497-506 (2014-08-08)
Germline loss-of-function mutations in PALB2 are known to confer a predisposition to breast cancer. However, the lifetime risk of breast cancer that is conferred by such mutations remains unknown. We analyzed the risk of breast cancer among 362 members of
Anar K Murphy et al.
The Journal of cell biology, 206(4), 493-507 (2014-08-13)
Phosphorylation of replication protein A (RPA) by Cdk2 and the checkpoint kinase ATR (ATM and Rad3 related) during replication fork stalling stabilizes the replisome, but how these modifications safeguard the fork is not understood. To address this question, we used

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico