Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU048531

Sigma-Aldrich

MISSION® esiRNA

targeting human VAV1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGCCACATGTTCCTCCTGATCGAGGACCAAGGTGCCCAGGGCTATGAGCTGTTCTTCAAGACAAGAGAATTGAAGAAGAAGTGGATGGAGCAGTTTGAGATGGCCATCTCCAACATCTATCCGGAGAATGCCACCGCCAACGGGCATGACTTCCAGATGTTCTCCTTTGAGGAGACCACATCCTGCAAGGCCTGTCAGATGCTGCTTAGAGGTACCTTCTATCAGGGCTACCGCTGCCATCGGTGCCGGGCATCTGCACACAAGGAGTGTCTGGGGAGGGTCCCTCCATGTGGCCGACATGGGCAAGATTTCCCAGGAACTATGAAGAAGGACAAACTACATCGCAGGGCTCAGGACAAAAAGAGGAATGAGCTGGGTCTGCCCAAGATGGAGGTGTTTCAGGAATACTACGGGCTTCCTCCACCCCCTGGAGCCATTGGACCCTTTCTACGGCT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Guillaume Gaud et al.
Science signaling, 11(538) (2018-07-12)
The activation of T cells requires the guanine nucleotide exchange factor VAV1. Using mice in which a tag for affinity purification was attached to endogenous VAV1 molecules, we analyzed by quantitative mass spectrometry the signaling complex that assembles around activated
Ying Zhou et al.
Journal of cellular biochemistry, 119(7), 5437-5448 (2018-01-26)
This study aims to explore the effect of miR-330 targeting VAV1 on amyloid β-protein (Aβ) production, oxidative stress (OS), and mitochondrial dysfunction in Alzheimer's disease (AD) mice through the MAPK signaling pathway. Putative targeted gene of miR-330 was performed by
Arathi Nair et al.
Cell communication and signaling : CCS, 18(1), 3-3 (2020-01-08)
Ras are small cellular GTPases which regulate diverse cellular processes. It has three isoforms: H-Ras, K-Ras, and N-Ras. Owing to the N-terminus (1-165 residues) sequence homology these isoforms were thought to be functionally redundant. However, only K-Ras-deficient mice but not
Silvia Grassilli et al.
Oncotarget, 5(12), 4320-4336 (2014-06-26)
Vav1 is one of the signalling proteins normally restricted to hematopoietic cells that results ectopically expressed in solid tumors, including breast cancer. By immunohistochemical analysis on TMAs containing invasive breast tumor from patients without lymph node involvement, we have found

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico